National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1273R-1 
 Symbol CG1273  Full Name CG1273 
 CG No CG1273  Old CG No CG1273 
 Synonyms CG1273 
 Accession No (Link to NCBI) NM_139626.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGCGTGAGTGATATATACAG 
 Primer Seq. 3'
aatctagaggtaccCATTGTCCATCATGGAACGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGCGTGAGT GATATATACA GGGCGCAGAC ATGTCGGCAA ATGAGCGCGG ACTATACATA 
0061 CCAGAACACA GTTGGCCGGA GGTCTCAGCT GGGGGCATAC TACCACATGA ACAAACAGCC 
0121 CTCGTACACC AATGAGCACA GTCTGAACAG TCAGTATGGA TACAATACGT GGGGCATATG 
0181 GCGGGATGGC AGGAACATCG CCCCATCCAC CTTCTCGGCC AAGACGCACA CGCAGTACCC 
0241 CAAGAATCGA TCATTCAGCA TTATCCTTAC AACGGCTGCA TTTATCGTCC TGCTGGCGGT 
0301 CATCTCAATC GCCGGATTGG CCTTTTACTT CAGCTCTATA AAAACCAATC TGGAGGATCC 
0361 TGTCATGGGC TTTGAGGGTT CCTTCCGCAT TGCCAAAGGG GATCTCTTCT CCACTGGTTT 
0421 GAAGTACAAC CACACCACCA CCTACAAACA GAAAATCGAT TTCTATAAGA GATTCGTGGA 
0481 GCGTTCCATG ATGGACAATG  
 in silico PCR Fragment
0001 CGGCGTGAGT GATATATACA GGGCGCAGAC ATGTCGGCAA ATGAGCGCGG ACTATACATA 
0061 CCAGAACACA GTTGGCCGGA GGTCTCAGCT GGGGGCATAC TACCACATGA ACAAACAGCC 
0121 CTCGTACACC AATGAGCACA GTCTGAACAG TCAGTATGGA TACAATACGT GGGGCATATG 
0181 GCGGGATGGC AGGAACATCG CCCCATCCAC CTTCTCGGCC AAGACGCACA CGCAGTACCC 
0241 CAAGAATCGA TCATTCAGCA TTATCCTTAC AACGGCTGCA TTTATCGTCC TGCTTACGGT 
0301 CATCTCAATC GCCGGATTGG CCTTTTACTT CAGCTCTATA AAAACCAATC TGGAGGATCC 
0361 TGTCATGGGC TTTGAGGGTT CCTTCCGCAT TGCCAAAGGG GATCTCTTCT CCACTGGTTT 
0421 GAAGTACAAC CACACCACCA CCTACAAACA GAAAATCGAT TTCTATAAGA GATTCGTGGA 
0481 GCGTTCCATG ATGGACAATG  
 Assemble Data

1273R-1.IR_full       1   CGGCGTGAGTGATATATACAGGGCGCAGACATGTCGGCAAATGAGCGCGGACTATACATA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1273R-1.in silico     1   CGGCGTGAGTGATATATACAGGGCGCAGACATGTCGGCAAATGAGCGCGGACTATACATA 60


1273R-1.IR_full       61  CCAGAACACAGTTGGCCGGAGGTCTCAGCTGGGGGCATACTACCACATGAACAAACAGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1273R-1.in silico     61  CCAGAACACAGTTGGCCGGAGGTCTCAGCTGGGGGCATACTACCACATGAACAAACAGCC 120


1273R-1.IR_full       121 CTCGTACACCAATGAGCACAGTCTGAACAGTCAGTATGGATACAATACGTGGGGCATATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1273R-1.in silico     121 CTCGTACACCAATGAGCACAGTCTGAACAGTCAGTATGGATACAATACGTGGGGCATATG 180


1273R-1.IR_full       181 GCGGGATGGCAGGAACATCGCCCCATCCACCTTCTCGGCCAAGACGCACACGCAGTACCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1273R-1.in silico     181 GCGGGATGGCAGGAACATCGCCCCATCCACCTTCTCGGCCAAGACGCACACGCAGTACCC 240


1273R-1.IR_full       241 CAAGAATCGATCATTCAGCATTATCCTTACAACGGCTGCATTTATCGTCCTGCTGGCGGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||
1273R-1.in silico     241 CAAGAATCGATCATTCAGCATTATCCTTACAACGGCTGCATTTATCGTCCTGCTTACGGT 300


1273R-1.IR_full       301 CATCTCAATCGCCGGATTGGCCTTTTACTTCAGCTCTATAAAAACCAATCTGGAGGATCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1273R-1.in silico     301 CATCTCAATCGCCGGATTGGCCTTTTACTTCAGCTCTATAAAAACCAATCTGGAGGATCC 360


1273R-1.IR_full       361 TGTCATGGGCTTTGAGGGTTCCTTCCGCATTGCCAAAGGGGATCTCTTCTCCACTGGTTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1273R-1.in silico     361 TGTCATGGGCTTTGAGGGTTCCTTCCGCATTGCCAAAGGGGATCTCTTCTCCACTGGTTT 420


1273R-1.IR_full       421 GAAGTACAACCACACCACCACCTACAAACAGAAAATCGATTTCTATAAGAGATTCGTGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1273R-1.in silico     421 GAAGTACAACCACACCACCACCTACAAACAGAAAATCGATTTCTATAAGAGATTCGTGGA 480


1273R-1.IR_full       481 GCGTTCCATGATGGACAATG 500
                          ||||||||||||||||||||
1273R-1.in silico     481 GCGTTCCATGATGGACAATG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139626.1  CG1273-RB (CG1273), mRNA 
0   NM_001031882.1  CG4523-RD, transcript variant D (Pink1), mRNA 
0   NM_167083.2  CG4523-RB, transcript variant B (Pink1), mRNA 
0   NM_132112.3  CG4523-RA, transcript variant A (Pink1), mRNA 
0   NM_001031883.1  CG4523-RC, transcript variant C (Pink1), mRNA 
0   NM_001031881.1  CG4523-RE, transcript variant E (Pink1), mRNA 
0   NM_001031880.1  CG4523-RF, transcript variant F (Pink1), mRNA 
0   NM_001031879.1  CG4523-RG, transcript variant G (Pink1), mRNA 
0   NM_001031878.1  CG4523-RH, transcript variant H (Pink1), mRNA 
0   NM_165461.1  CG1765-RA, transcript variant A (EcR), mRNA 
0   NM_165463.1  CG1765-RE, transcript variant E (EcR), mRNA 
0   NM_165462.1  CG1765-RD, transcript variant D (EcR), mRNA 
0   NM_165464.1  CG1765-RC, transcript variant C (EcR), mRNA 
0   NM_165465.1  CG1765-RB, transcript variant B (EcR), mRNA 
0   NM_141633.1  CG8135-RA (CG8135), mRNA 
0   NM_137814.1  CG3382-RA (Oatp58Db), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_001015096.1  CG40263-PB.3 (CG40263), mRNA 
0   NM_001015095.1  CG40263-PA.3 (CG40263), mRNA 
0   NM_165699.1  CG1623-RB, transcript variant B (CG1623), mRNA 
0   NM_165700.1  CG1623-RD, transcript variant D (CG1623), mRNA 
0   NM_165698.1  CG1623-RA, transcript variant A (CG1623), mRNA 
0   NM_136676.2  CG1623-RC, transcript variant C (CG1623), mRNA 
0   NM_165701.1  CG1623-RE, transcript variant E (CG1623), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.