National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1265R-1 
 Symbol CG1265  Full Name CG1265 
 CG No CG1265  Old CG No CG1265 
 Synonyms BcDNA:RE09466, CG1265 
 Accession No (Link to NCBI) NM_139621.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGGAGCTCTCGGAGATGTG 
 Primer Seq. 3'
aatctagaggtaccGTTCTACTGACGGAACTGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTGGAGCTC TCGGAGATGT GGTGTCCGAA TACCTGGAGC GCGGCCCAGT GCTCGTGGTG 
0061 GCGGACCTCC TTAGCCTGAT AACGGTCTCG TCCTGCCTGG TGATCAAGGT TCCGCAGATA 
0121 AACACGATAC GGGCGAACGA GTCCTCGAAA GGCATCAGTG TTTTGGGACT GTGCCTGGAG 
0181 CTGTTCAGTT ATACGGTGAT GTTGTCGTAC AACTACACCA GTGGCTACGA CTTCCTCTCG 
0241 TACATGGAGT ATCCTGTTTT GCTGCTGCAG GAGTACGCCC TGATTTACTA CGCCTTCAAG 
0301 TACCAGGATC TGCTGGGAAA GGAGGACGCA AGTGGTGGCC ATACTGTATA GTATAGTGGC 
0361 CACTCTCATA TACATGAAGC TCTTTCCCAT TATCATCCTT AAGTTCCTGG TGCCTTTCTG 
0421 CACTCCCATT GGAGCCACGA GTAAGGTCCT CCAGCTGCTG GCTATTCTGA GGACCAAGGA 
0481 TGCCAGTTCC GTCAGTAGAA C 
 in silico PCR Fragment
0001 AGTGGAGCTC TCGGAGATGT GGTGTCCGAA TACCTGGAGC GCGGCCCAGT GCTCGTGGTG 
0061 GCGGACCTCC TTAGCCTGAT AACGGTCTCG TCCTGCCTGG TGATCAAGGT TCCGCAGATA 
0121 AACACGATAC GGGCGAACGA GTCCTCGAAA GGCATCAGTG TTTTGGGACT GTGCCTGGAG 
0181 CTGTTCAGTT ATACGGTGAT GTTGTCGTAC AACTACACCA GTGGCTACGA CTTCCTCTCG 
0241 TACATGGAGT ATCCTGTTTT GCTGCTGCAG GAGTACGCCC TGATTTACTA CGCCTTCAAG 
0301 TACCAGGATC TGCTGGG-AA GGAGGACGCA AGTGGTGGCC ATACTGTATA GTATAGTGGC 
0361 CACTCTCATA TACATGAAGC TCTTTCCCAT TATCATCCTT AAGTTCCTGG TGCCTTTCTG 
0421 CACTCCCATT GGAGCCACGA GTAAGGTCCT CCAGCTGCTG GCTATTCTGA GGACCAAGGA 
0481 TGCCAGTTCC GTCAGTAGAA C 
 Assemble Data

1265R-1.IR_full       1   AGTGGAGCTCTCGGAGATGTGGTGTCCGAATACCTGGAGCGCGGCCCAGTGCTCGTGGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     1   AGTGGAGCTCTCGGAGATGTGGTGTCCGAATACCTGGAGCGCGGCCCAGTGCTCGTGGTG 60


1265R-1.IR_full       61  GCGGACCTCCTTAGCCTGATAACGGTCTCGTCCTGCCTGGTGATCAAGGTTCCGCAGATA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     61  GCGGACCTCCTTAGCCTGATAACGGTCTCGTCCTGCCTGGTGATCAAGGTTCCGCAGATA 120


1265R-1.IR_full       121 AACACGATACGGGCGAACGAGTCCTCGAAAGGCATCAGTGTTTTGGGACTGTGCCTGGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     121 AACACGATACGGGCGAACGAGTCCTCGAAAGGCATCAGTGTTTTGGGACTGTGCCTGGAG 180


1265R-1.IR_full       181 CTGTTCAGTTATACGGTGATGTTGTCGTACAACTACACCAGTGGCTACGACTTCCTCTCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     181 CTGTTCAGTTATACGGTGATGTTGTCGTACAACTACACCAGTGGCTACGACTTCCTCTCG 240


1265R-1.IR_full       241 TACATGGAGTATCCTGTTTTGCTGCTGCAGGAGTACGCCCTGATTTACTACGCCTTCAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     241 TACATGGAGTATCCTGTTTTGCTGCTGCAGGAGTACGCCCTGATTTACTACGCCTTCAAG 300


1265R-1.IR_full       301 TACCAGGATCTGCTGGGAAAGGAGGACGCAAGTGGTGGCCATACTGTATAGTATAGTGGC 360
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     301 TACCAGGATCTGCTGGG-AAGGAGGACGCAAGTGGTGGCCATACTGTATAGTATAGTGGC 360


1265R-1.IR_full       361 CACTCTCATATACATGAAGCTCTTTCCCATTATCATCCTTAAGTTCCTGGTGCCTTTCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     361 CACTCTCATATACATGAAGCTCTTTCCCATTATCATCCTTAAGTTCCTGGTGCCTTTCTG 420


1265R-1.IR_full       421 CACTCCCATTGGAGCCACGAGTAAGGTCCTCCAGCTGCTGGCTATTCTGAGGACCAAGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1265R-1.in silico     421 CACTCCCATTGGAGCCACGAGTAAGGTCCTCCAGCTGCTGGCTATTCTGAGGACCAAGGA 480


1265R-1.IR_full       481 TGCCAGTTCCGTCAGTAGAAC 501
                          |||||||||||||||||||||
1265R-1.in silico     481 TGCCAGTTCCGTCAGTAGAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139621.1  CG1265-RB (CG1265), mRNA 
0   NM_139450.2  CG5714-RA (ecd), mRNA 
0   NM_167201.2  CG1354-RC, transcript variant C (CG1354), mRNA 
0   NM_167202.2  CG1354-RD, transcript variant D (CG1354), mRNA 
0   NM_132352.2  CG1354-RA, transcript variant A (CG1354), mRNA 
0   NM_167203.1  CG1354-RB, transcript variant B (CG1354), mRNA 
0   NM_079749.4  CG5405-RA, transcript variant A (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   NM_136132.4  CG10084-RA, transcript variant A (swm), mRNA 
0   NM_165304.1  CG10084-RB, transcript variant B (swm), mRNA 
0   NM_132014.2  CG4119-RA (CG4119), mRNA 
0   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_143391.1  CG11828-RA (CG11828), mRNA 
0   10  NM_132008.3  CG32763-RA (l(1)G0045), mRNA 
0   NM_142521.1  CG6026-RA (CG6026), mRNA 
0   NM_079806.2  CG31062-RA (side), mRNA 
0   NM_079473.2  CG7758-RA (ppl), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_079963.3  CG7449-RA, transcript variant A (hbs), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 
0   NM_176175.1  CG7449-RB, transcript variant B (hbs), mRNA 
0   NM_134725.1  CG4552-RA (CG4552), mRNA 
0   NM_139966.2  CG18543-RA (mtrm), mRNA 
0   NM_143310.2  CG12885-RA (CG12885), mRNA 
0   NM_135042.2  CG14043-RA (CG14043), mRNA 
0   NM_137948.1  CG3520-RA (CG3520), mRNA 
0   NM_139562.1  CG14973-RA (CG14973), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.