National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12611R-2 
 Symbol Andorra  Full Name Andorra 
 CG No CG12611  Old CG No CG12611 
 Synonyms CG12611, Andorra 
 Accession No (Link to NCBI) NM_133044.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGCGCGATCTCTACGAGAC 
 Primer Seq. 3'
aatctagaggtaccCCAAGGACACCCGCCATTCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGCGCGAT CTCTACGAGA CCTGGCTAAT CCTGGCCATT GGCATGTTGG TGCGCTGGAA 
0061 TCGCTGGCGT CCGTTGATCC ATGGCATGGT ATCGCCACTG GATCCATCGC TTAAGCACAT 
0121 CGTGGGCGAC AATGAACGCT GGGCGGGAGT CTACTTTGGA TGCGGCACAC TCATGACCAT 
0181 CATGCAGTAT CGATCACTTT GGGTGCGCCG GTGTCGTCAC CGCGTCCACA TCCTGATGCT 
0241 GCTGTCCGAA ATAATGCTAC TGCTCCAGCT GGTGCACTGG ATCGACTGCC AGCTGTGGCA 
0301 ATCCTTTCTG AGCCTCTTCG AGGAGCTCTT CATCGCCCTG GGACGCGGTC AATGGGGCTC 
0361 CTGGATCTTT TGCTGTCCGG CCGCAGTGCG CAATCTGTTC CTGCGTGGCG ATGTCTTCGA 
0421 TGTGTTCCGC TTGCTCGCCT CGTTCGCCAT CTTCGCCGTG GCCCTAAACT CGACAGCTGG 
0481 TGAATGGCGG GTGTCCTTGG  
 in silico PCR Fragment
0001 GCTGCGCGAT CTCTACGAGA CCTGGCTAAT CCTGGCCATT GGCATGTTGG TGCGCTGGAA 
0061 TCGCTGGCGT CCGTTGATCC ATGGCATGGT ATCGCCACTG GATCCATCGC TTAAGCACAT 
0121 CGTGGGCGAC AATGAACGCT GGGCGGGAGT CTACTTTGGA TGCGGCACAC TCATGACCAT 
0181 CATGCAGTAT CGATCACTTT GGGTGCGCCG GTGTCGTCAC CGCGTCCACA TCCTGATGCT 
0241 GCTGTCCGAA ATAATGCTAC TGCTCCAGCT GGTGCACTGG ATCGACTGCC AGCTGTGGCA 
0301 ATCCTTTCTG AGCCTCTTCG AGGAGCTCTT CATCGCCCTG GGACGCGGTC AATGGGGCTC 
0361 CTGGATCTTT TGCTGTCCGG CCGCAGTGCG CAATCTGTTC CTGCGTGGCG ATGTCTTCGA 
0421 TGTGTTCCGC TTGCTCGCCT CGTTCGCCAT CTTCGCCGTG GCCCTAAACT CGACAGCTGG 
0481 TGAATGGCGG GTGTCCTTGG  
 Assemble Data

12611R-2.IR_full       1   GCTGCGCGATCTCTACGAGACCTGGCTAATCCTGGCCATTGGCATGTTGGTGCGCTGGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     1   GCTGCGCGATCTCTACGAGACCTGGCTAATCCTGGCCATTGGCATGTTGGTGCGCTGGAA 60


12611R-2.IR_full       61  TCGCTGGCGTCCGTTGATCCATGGCATGGTATCGCCACTGGATCCATCGCTTAAGCACAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     61  TCGCTGGCGTCCGTTGATCCATGGCATGGTATCGCCACTGGATCCATCGCTTAAGCACAT 120


12611R-2.IR_full       121 CGTGGGCGACAATGAACGCTGGGCGGGAGTCTACTTTGGATGCGGCACACTCATGACCAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     121 CGTGGGCGACAATGAACGCTGGGCGGGAGTCTACTTTGGATGCGGCACACTCATGACCAT 180


12611R-2.IR_full       181 CATGCAGTATCGATCACTTTGGGTGCGCCGGTGTCGTCACCGCGTCCACATCCTGATGCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     181 CATGCAGTATCGATCACTTTGGGTGCGCCGGTGTCGTCACCGCGTCCACATCCTGATGCT 240


12611R-2.IR_full       241 GCTGTCCGAAATAATGCTACTGCTCCAGCTGGTGCACTGGATCGACTGCCAGCTGTGGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     241 GCTGTCCGAAATAATGCTACTGCTCCAGCTGGTGCACTGGATCGACTGCCAGCTGTGGCA 300


12611R-2.IR_full       301 ATCCTTTCTGAGCCTCTTCGAGGAGCTCTTCATCGCCCTGGGACGCGGTCAATGGGGCTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     301 ATCCTTTCTGAGCCTCTTCGAGGAGCTCTTCATCGCCCTGGGACGCGGTCAATGGGGCTC 360


12611R-2.IR_full       361 CTGGATCTTTTGCTGTCCGGCCGCAGTGCGCAATCTGTTCCTGCGTGGCGATGTCTTCGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     361 CTGGATCTTTTGCTGTCCGGCCGCAGTGCGCAATCTGTTCCTGCGTGGCGATGTCTTCGA 420


12611R-2.IR_full       421 TGTGTTCCGCTTGCTCGCCTCGTTCGCCATCTTCGCCGTGGCCCTAAACTCGACAGCTGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12611R-2.in silico     421 TGTGTTCCGCTTGCTCGCCTCGTTCGCCATCTTCGCCGTGGCCCTAAACTCGACAGCTGG 480


12611R-2.IR_full       481 TGAATGGCGGGTGTCCTTGG 500
                           ||||||||||||||||||||
12611R-2.in silico     481 TGAATGGCGGGTGTCCTTGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_133044.2  CG12611-RA (Andorra), mRNA 
0   NM_137528.3  CG15078-RA, transcript variant A (Mctp), mRNA 
0   NM_001043094.1  CG15078-RC, transcript variant C (Mctp), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_130535.2  CG11380-RA (CG11380), mRNA 
0   NM_140225.3  CG6091-RA, transcript variant A (CG6091), mRNA 
0   NM_168465.2  CG6091-RC, transcript variant C (CG6091), mRNA 
0   NM_169616.2  CG4154-RA, transcript variant A (Gyc88E), mRNA 
0   NM_142167.2  CG4154-RC, transcript variant C (Gyc88E), mRNA 
0   NM_001043246.1  CG4154-RD, transcript variant D (Gyc88E), mRNA 
0   NM_136549.1  CG14752-RA (CG14752), mRNA 
0   NM_168460.1  CG11711-RD, transcript variant D (Mob1), mRNA 
0   NM_168961.2  CG32451-RB, transcript variant B (SPoCk), mRNA 
0   NM_132256.1  CG15350-RA (Cp7Fb), mRNA 
0   NM_143025.1  CG13632-RA (CG13632), mRNA 
0   NM_164692.2  CG31638-RA (CG31638), mRNA 
0   NM_144405.1  CG18779-RA (CG18779), mRNA 
0   NM_132910.1  CG9777-RA (CG9777), mRNA 
0   NM_057924.2  CG10534-RA (Lcp65Ag2), mRNA 
0   NM_057925.2  CG10530-RA (Lcp65Ag1), mRNA 
0   NM_079674.2  CG16740-RA (Rh2), mRNA 
0   11  NM_176543.1  CG17119-RB, transcript variant B (CG17119), mRNA 
0   11  NM_142859.2  CG17119-RA, transcript variant A (CG17119), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_137235.2  CG8399-RA (CG8399), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_078567.3  CG17867-RA (Or10a), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   NM_142019.2  CG32473-RB, transcript variant B (CG32473), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.