National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12602R-3 
 Symbol CG12602  Full Name CG12602 
 CG No CG12602  Old CG No CG12602 
 Synonyms CG12602 
 Accession No (Link to NCBI) NM_135671.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| silico     1   ATGGCCCTGTGCCAGCTGTTCATCCAGCCGGAGGCAGCCTACGCCTCCATTGCCGAGCTG 60

                           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGCGA-AAAAGGATGTGTCCAGTTTCGCGATCTGAACGAGGAGGTCAGTGCTTTCCAGCG 120

                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| silico     121 AAAGTACGTCAACGAGGTCAGGAGATGTGATGACATGGA-GCGCCGCCTCCGG-TACGTG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGTCCGAGATGAAGAAGGACGAGGTAAAGCTGCCAGTCCTGCGACCGGAGGAGGAGCCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATTGCTCCCAATCCCCGCGAGATCGTAGACCTTGAGGCTCAGCTGGAGAAGACCGACAAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAACTGCGCGAAATGTCCGCCAATGGAGCGAGTTTGGATGCCAACTTCCGGCACATGCAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAACTCAAATACGTGCTAGAGAACACCGAGGGCTTCTTCTCCGATCAGGAAGTCATTAAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTGGACGTCAACCGAAAACTGGACCCCGAGGATCCGGCCAATTTGCCAGGAGCCGCCCAG 480

12602R-3.IR_full       481 CGGGGTCAACTGGCCTTTGTTGC 503
                           ||||||||||||||||||||||| silico     481 CGGGGTCAACTGGCCTTTGTTGC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135671.1  CG12602-RA (CG12602), mRNA 
0.62   NM_142071.2  CG3061-RA (CG3061), mRNA 
0.2   12  NM_142463.2  CG7678-RA (CG7678), mRNA 
0   34  46  NM_169810.1  CG18617-RA, transcript variant A (Vha100-2), mRNA 
0   34  46  NM_142465.1  CG18617-RB, transcript variant B (Vha100-2), mRNA 
0   NM_080170.2  CG11156-RA (mus101), mRNA 
0   25  NM_170391.1  CG1709-RC, transcript variant C (Vha100-1), mRNA 
0   25  NM_170393.1  CG1709-RF, transcript variant F (Vha100-1), mRNA 
0   25  NM_170394.1  CG1709-RG, transcript variant G (Vha100-1), mRNA 
0   25  NM_170395.1  CG1709-RB, transcript variant B (Vha100-1), mRNA 
0   25  NM_170392.1  CG1709-RA, transcript variant A (Vha100-1), mRNA 
0   25  NM_170396.1  CG1709-RD, transcript variant D (Vha100-1), mRNA 
0   25  NM_143415.2  CG1709-RE, transcript variant E (Vha100-1), mRNA 
0   NM_206074.1  CG12908-RB, transcript variant B (Ndg), mRNA 
0   NM_136731.1  CG12908-RA, transcript variant A (Ndg), mRNA 
0   NM_141644.2  CG9379-RA (by), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_141511.2  CG9667-RA (CG9667), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_166484.1  CG17952-RC, transcript variant C (LBR), mRNA 
0   NM_137764.2  CG17952-RA, transcript variant A (LBR), mRNA 
0   NM_001031897.1  CG8923-RC, transcript variant C (mei-218), mRNA 
0   NM_001031898.1  CG33935-RA, transcript variant A (mei-217), mRNA 
0   NM_166485.1  CG17952-RB, transcript variant B (LBR), mRNA 
0   NM_134595.2  CG1724-RA (CG1724), mRNA 
0   10  NM_078781.1  CG6641-RA (Pbprp5), mRNA 
0   16  NM_206123.1  CG33464-RA (CG33464), mRNA 
0   NM_132214.1  CG15335-RB (CG15335), mRNA 
0   NM_142697.2  CG5862-RA (CG5862), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.