National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12602R-1 
 Symbol CG12602  Full Name CG12602 
 CG No CG12602  Old CG No CG12602 
 Synonyms CG12602 
 Accession No (Link to NCBI) NM_135671.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCCTGTGCCAGCTGTTC 
 Primer Seq. 3'
aatctagaggtaccGCAACAAAGGCCAGTTGACCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCCTGT NCCAGCTGTT CGTCCAGCCg GAGGCAgCCT ACGCCTCCAT TGCCGAGCTG 
0061 GGCGANAAAA GGATGTGTCC AGTTTCGCGA TCTGAACGAG GAGGTCAGTG CTTTCCAGCG 
0121 AAAGTACGTC AACGAGGTCA GGAGATGTGA TGACATGGAN GCGCCGCCTC CGGNTACGTG 
0181 GAGTCCGAGA TGAAGAAGGA CGAGGTAAAG CTGCCAGTCC TGCGACCGGA GGAGGAGCCC 
0241 ATTGCTCCCA ATCCCCGCGA GATCGTAGAC CTTGAGGCTC AGCTGGAGAA GACCGACAAT 
0301 GAACTGCGCG AAATGTCCGC CAATGGAGCG AGTTTGGATG CCAACTTCCG GCACATGCAA 
0361 GAACTCAAAT ACGTGCTAGA GAACACCGAG GGCTTCTTCT CCGATCAGGA AGTCATTAAT 
0421 CTGGACGTCA ACCGAAAACT GGACCCCGAG GATCCGGCCA ATTTGCCAGG AGCcgCCCAG 
0481 CGGGGTCAAC TGGCCTTTGT TGC 
 in silico PCR Fragment
0001 ATGGCCCTGT GCCAGCTGTT CATCCAGCCG GAGGCAGCCT ACGCCTCCAT TGCCGAGCTG 
0061 GGCGA-AAAA GGATGTGTCC AGTTTCGCGA TCTGAACGAG GAGGTCAGTG CTTTCCAGCG 
0121 AAAGTACGTC AACGAGGTCA GGAGATGTGA TGACATGGA- GCGCCGCCTC CGG-TACGTG 
0181 GAGTCCGAGA TGAAGAAGGA CGAGGTAAAG CTGCCAGTCC TGCGACCGGA GGAGGAGCCC 
0241 ATTGCTCCCA ATCCCCGCGA GATCGTAGAC CTTGAGGCTC AGCTGGAGAA GACCGACAAT 
0301 GAACTGCGCG AAATGTCCGC CAATGGAGCG AGTTTGGATG CCAACTTCCG GCACATGCAA 
0361 GAACTCAAAT ACGTGCTAGA GAACACCGAG GGCTTCTTCT CCGATCAGGA AGTCATTAAT 
0421 CTGGACGTCA ACCGAAAACT GGACCCCGAG GATCCGGCCA ATTTGCCAGG AGCCGCCCAG 
0481 CGGGGTCAAC TGGCCTTTGT TGC 
 Assemble Data

12602R-1.IR_full       1   ATGGCCCTGTNCCAGCTGTTCGTCCAGCCGGAGGCAGCCTACGCCTCCATTGCCGAGCTG 60
                           |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||
12602R-1.in silico     1   ATGGCCCTGTGCCAGCTGTTCATCCAGCCGGAGGCAGCCTACGCCTCCATTGCCGAGCTG 60


12602R-1.IR_full       61  GGCGANAAAAGGATGTGTCCAGTTTCGCGATCTGAACGAGGAGGTCAGTGCTTTCCAGCG 120
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
12602R-1.in silico     61  GGCGA-AAAAGGATGTGTCCAGTTTCGCGATCTGAACGAGGAGGTCAGTGCTTTCCAGCG 120


12602R-1.IR_full       121 AAAGTACGTCAACGAGGTCAGGAGATGTGATGACATGGANGCGCCGCCTCCGGNTACGTG 180
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||
12602R-1.in silico     121 AAAGTACGTCAACGAGGTCAGGAGATGTGATGACATGGA-GCGCCGCCTCCGG-TACGTG 180


12602R-1.IR_full       181 GAGTCCGAGATGAAGAAGGACGAGGTAAAGCTGCCAGTCCTGCGACCGGAGGAGGAGCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12602R-1.in silico     181 GAGTCCGAGATGAAGAAGGACGAGGTAAAGCTGCCAGTCCTGCGACCGGAGGAGGAGCCC 240


12602R-1.IR_full       241 ATTGCTCCCAATCCCCGCGAGATCGTAGACCTTGAGGCTCAGCTGGAGAAGACCGACAAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12602R-1.in silico     241 ATTGCTCCCAATCCCCGCGAGATCGTAGACCTTGAGGCTCAGCTGGAGAAGACCGACAAT 300


12602R-1.IR_full       301 GAACTGCGCGAAATGTCCGCCAATGGAGCGAGTTTGGATGCCAACTTCCGGCACATGCAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12602R-1.in silico     301 GAACTGCGCGAAATGTCCGCCAATGGAGCGAGTTTGGATGCCAACTTCCGGCACATGCAA 360


12602R-1.IR_full       361 GAACTCAAATACGTGCTAGAGAACACCGAGGGCTTCTTCTCCGATCAGGAAGTCATTAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12602R-1.in silico     361 GAACTCAAATACGTGCTAGAGAACACCGAGGGCTTCTTCTCCGATCAGGAAGTCATTAAT 420


12602R-1.IR_full       421 CTGGACGTCAACCGAAAACTGGACCCCGAGGATCCGGCCAATTTGCCAGGAGCCGCCCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12602R-1.in silico     421 CTGGACGTCAACCGAAAACTGGACCCCGAGGATCCGGCCAATTTGCCAGGAGCCGCCCAG 480


12602R-1.IR_full       481 CGGGGTCAACTGGCCTTTGTTGC 503
                           |||||||||||||||||||||||
12602R-1.in silico     481 CGGGGTCAACTGGCCTTTGTTGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135671.1  CG12602-RA (CG12602), mRNA 
0.62   NM_142071.2  CG3061-RA (CG3061), mRNA 
0.2   12  NM_142463.2  CG7678-RA (CG7678), mRNA 
0   34  46  NM_169810.1  CG18617-RA, transcript variant A (Vha100-2), mRNA 
0   34  46  NM_142465.1  CG18617-RB, transcript variant B (Vha100-2), mRNA 
0   NM_080170.2  CG11156-RA (mus101), mRNA 
0   25  NM_170391.1  CG1709-RC, transcript variant C (Vha100-1), mRNA 
0   25  NM_170393.1  CG1709-RF, transcript variant F (Vha100-1), mRNA 
0   25  NM_170394.1  CG1709-RG, transcript variant G (Vha100-1), mRNA 
0   25  NM_170395.1  CG1709-RB, transcript variant B (Vha100-1), mRNA 
0   25  NM_170392.1  CG1709-RA, transcript variant A (Vha100-1), mRNA 
0   25  NM_170396.1  CG1709-RD, transcript variant D (Vha100-1), mRNA 
0   25  NM_143415.2  CG1709-RE, transcript variant E (Vha100-1), mRNA 
0   NM_206074.1  CG12908-RB, transcript variant B (Ndg), mRNA 
0   NM_136731.1  CG12908-RA, transcript variant A (Ndg), mRNA 
0   NM_141644.2  CG9379-RA (by), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_141511.2  CG9667-RA (CG9667), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_166484.1  CG17952-RC, transcript variant C (LBR), mRNA 
0   NM_137764.2  CG17952-RA, transcript variant A (LBR), mRNA 
0   NM_001031897.1  CG8923-RC, transcript variant C (mei-218), mRNA 
0   NM_001031898.1  CG33935-RA, transcript variant A (mei-217), mRNA 
0   NM_166485.1  CG17952-RB, transcript variant B (LBR), mRNA 
0   NM_134595.2  CG1724-RA (CG1724), mRNA 
0   10  NM_078781.1  CG6641-RA (Pbprp5), mRNA 
0   16  NM_206123.1  CG33464-RA (CG33464), mRNA 
0   NM_132214.1  CG15335-RB (CG15335), mRNA 
0   NM_142697.2  CG5862-RA (CG5862), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.