National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12564Ra-1 
 Symbol CG12564  Full Name CG12564 
 CG No CG12564  Old CG No CG12564 
 Synonyms 42343,BcDNA:RE23430,BP1062,CG12564,CG12565,CG14583,CG34019,CG42343,CT34319,DIP-beta,DIP-,pp-CT34319,pp-CT34320,pp-CT34321,Dpr-interacting protein  
 Accession No (Link to NCBI) NM_134610.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAACCGGCGCTGTCATCAACT 
 Primer Seq. 3'
aatctagaggtaccGGCCTTTTCAACTTTGCAGAG 
 Predicted Fragment Size
433 
 IR fragment full Seq
0001 AAACCGGCGC TGTCATCAAC TCAACAACAA CAATGGTCAT CCCTTTATCC CCACTTCCAT 
0061 TTCCNCGATT TCCCCCGATT TACCCCGACT TACCACGATT TTCCTCGATT TCCCTCGATT 
0121 TCCCTGGATT TCCCCCCATT GTGCTCATTG TGCCCAAATG TCACCCCCGT TTCCATTTGG 
0181 CAAACTGGCA CCNTCAGGCG CCTGGATTAA GGCCGATGCC AAGGCAATTC TGGCCATTCA 
0241 CGAGCACGTG ATAACCAACA ATGATCGATT ATCGGTGCAG CACAACGACT ACAACACATG 
0301 GACGCTCAAC ATACGCGGCG TCAAAATGGA GGACGCCGGC AAATACATGT GTCAGGTCAA 
0361 CACGGATCCC ATGAAGATGC AGGTGAGTGC GGCGAGTTCA CAGCGGGTTC CGAATCTCCN 
0421 AATGTCTTGC CCGGAAAAAA GAATCATTTG TTTTCTGTCC AGATTATAAT AAATGTCGCT 
0481 GCCACCGGTT ACTCTGCAAA GTTGAAAAGG CC 
 in silico PCR Fragment
0001 AAACCGGCGC TGTCATCAAC TCAACAACAA CAATGGTCAT CCCTTTATCC CCACTTCCAT 
0061 TTCCCCGATT TCCCCCGATT TACCCCGACT TACCACGATT TTCCTCGATT TCCCTCGATT 
0121 TCCCTGGATT TCCCCCCATT GTGCTCATTG TGCCCAAATG TCACCCCCGT TTCCATTTGG 
0181 CAAACTGGCA CCATCAGGTC GCCTGGATTA AGGCCGATGC CAAGGCAATT CTGGCCATTC 
0241 ACGAGCACGT GATAACCAAC AATGATCGAT TATCGGTGCA GCACAACGAC TACAACACAT 
0301 GGACGCTCAA CATACGCGGC GTCAAAATGG AGGACGCCGG CAAATACATG TGTCAGGTCA 
0361 ACACGGATCC CATGAAGATG CAGATTATAA TAAATGTCGC TGCCACCGGT TACTCTGCAA 
0421 AGTTGAAAAG GCC 
 Assemble Data

12564Ra-1.IR full       1   AAACCGGCGCTGTCATCAACTCAACAACAACAATGGTCATCCCTTTATCCCCACTTCCAT 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12564Ra-1.in silico     1   AAACCGGCGCTGTCATCAACTCAACAACAACAATGGTCATCCCTTTATCCCCACTTCCAT 60


12564Ra-1.IR full       61  TTCCNCGATTTCCCCCGATTTACCCCGACTTACCACGATTTTCCTCGATTTCCCTCGATT 120
                            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
12564Ra-1.in silico     61  TTCCCCGATTTCCCCCGATTTACCCCGACTTACCACGATTTTCCTCGATTTCCCTCGATT 120


12564Ra-1.IR full       121 TCCCTGGATTTCCCCCCATTGTGCTCATTGTGCCCAAATGTCACCCCCGTTTCCATTTGG 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12564Ra-1.in silico     121 TCCCTGGATTTCCCCCCATTGTGCTCATTGTGCCCAAATGTCACCCCCGTTTCCATTTGG 180


12564Ra-1.IR full       181 CAAACTGGCACCNTCAGG-CGCCTGGATTAAGGCCGATGCCAAGGCAATTCTGGCCATTC 240
                            |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
12564Ra-1.in silico     181 CAAACTGGCACCATCAGGTCGCCTGGATTAAGGCCGATGCCAAGGCAATTCTGGCCATTC 240


12564Ra-1.IR full       241 ACGAGCACGTGATAACCAACAATGATCGATTATCGGTGCAGCACAACGACTACAACACAT 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12564Ra-1.in silico     241 ACGAGCACGTGATAACCAACAATGATCGATTATCGGTGCAGCACAACGACTACAACACAT 300


12564Ra-1.IR full       301 GGACGCTCAACATACGCGGCGTCAAAATGGAGGACGCCGGCAAATACATGTGTCAGGTCA 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12564Ra-1.in silico     301 GGACGCTCAACATACGCGGCGTCAAAATGGAGGACGCCGGCAAATACATGTGTCAGGTCA 360


12564Ra-1.IR full       361 ACACGGATCCCATGAAGATGCAGGTGAGTGCGGCGAGTTCACAGCGGGTTCCGAATCTCC 420
                            ||||||||||||||||||||||| |   |      | |     |  | | ||      ||
12564Ra-1.in silico     361 ACACGGATCCCATGAAGATGCAGAT---TATAATAAAT-----GTCGCTGCCA-----CC 420


12564Ra-1.IR full        421 AATGTCTTGCCCGGAAAAAAGAATCATTTGTTTTCTGTCCAGATTATAATAAATGTCGC 479
                               |    |||   |   |||    |                                  
12564Ra-1.in silico      421 GTTACTCTGCAAAGTTGAAAAGGCC---------------------------------- 479


12564Ra-1.IR full       481 TGCCACCGGTTACTCTGCAAAGTTGAAAAGGCC 512
                                                             
12564Ra-1.in silico     481 --------------------------------- 512

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   415  12  40  56  NM_134610.1  CG12564-RA (CG12564), mRNA 
0.72   12  NM_135209.1  CG11320-RA (CG11320), mRNA 
0.24   11  NM_164653.1  CG31646-RA (CG31646), mRNA 
0   10  NM_079996.2  CG18024-RA (SoxN), mRNA 
0   NM_078880.2  CG10443-RA (Lar), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   20  NM_164934.1  CG7400-RB, transcript variant B (Fatp), mRNA 
0   20  NM_079984.2  CG7400-RA, transcript variant A (Fatp), mRNA 
0   NM_139790.1  CG8270-RA (CG8270), mRNA 
0   NM_141850.2  CG14718-RA (CG14718), mRNA 
0   NM_140743.1  CG7484-RB (CG7484), mRNA 
0   NM_080138.2  CG1618-RA (comt), mRNA 
0   NM_001014485.1  CG33515-RA (CG33515), mRNA 
0   NM_176002.1  CG32982-RB, transcript variant B (CG32982), mRNA 
0   NM_001042884.1  CG32982-RC, transcript variant C (CG32982), mRNA 
0   NM_176001.1  CG32982-RA, transcript variant A (CG32982), mRNA 
0   23  NM_166976.1  CG32791-RA (CG32791), mRNA 
0   12  NM_135102.1  CG14010-RA (CG14010), mRNA 
0   NM_057489.3  CG4722-RA (bib), mRNA 
0   NM_135193.2  CG9543-RA (epsilonCOP), mRNA 
0   NM_143179.1  CG5890-RA (CG5890), mRNA 
0   24  70  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   NM_135844.2  CG16886-RA (CG16886), mRNA 
0   NM_165611.1  CG8643-RA (rgr), mRNA 
0   NM_137610.1  CG18416-RA (CG18416), mRNA 
0   11  NM_165049.1  CG31814-RA (CG31814), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.