National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12498R-3 
 Symbol CG12498  Full Name CG12498 
 CG No CG12498  Old CG No CG12498 
 Synonyms EG:BACR43E12.1, CG12498 
 Accession No (Link to NCBI) NM_130674.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCAGCGATCCCGACACGTTC 
 Primer Seq. 3'
aatctagaggtaccTATGTGGGTGGTGGGTGGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCAGCGATC CCGACACGTT CGTCGTCCGG CAGCGGAAAT AGTCCGCGAA CTGAGGAACC 
0061 TTCGCGCCTC GCCTCTGCGG ATCGACGACG AGAACGAGTC GTGGGTGAAT GGCTACGAGA 
0121 AGCCACCAAC TCCGGATCTA CCGGTGACCA GTCGCGATCA GTTGGAGCTG CTACGTCTGA 
0181 GCCGCCATCG AATCGGTCTG CTTCTGGTTC GACCCGCCTT CGAGCAGGCC GTCACTGGAT 
0241 GCTTTGTCCG CGTGAATGTC AGTGGGCAGG GAGAGTTGCC TGATCATCGA ATCGCCGAGG 
0301 TGCTGGGCAT CTGCGAACTG GACTTTGGCT ACAAAGTGGA GCAGATACCC ACGAATGTGN 
0361 CGCTGCGATT GCGCTACGAT GACCTGGAGA TGCAGCACGA GATTAACGAT GTCTCTAACC 
0421 TGAACTTCAC CCAGGAGGAA TTCGAACTGT GGCGCGATAA CTGTGTTAAC CAGGCCATAA 
0481 GTCCACCCAC CACCCACATA  
 in silico PCR Fragment
0001 ACCAGCGATC CCGACACGTT CGTCGTCCGG CAGCGGAAAT AGTCCGCGAA CTGAGGAATC 
0061 TTCGCGCCTC GCCTCTGCGG ATCGACGACG AGAACGAGTC GTGGGTGAAT GGCTACGAGA 
0121 AGCCACCAAC TCCGGATCTA CCGGTGACCA GTCGCGATCA GTTGGAGCTG CTACGTCTGA 
0181 GCCGCCATCG AATCGGTCTG CTTCTGGTTC GACCCGCCTT CGAGCAGGCC GTCACTGGAT 
0241 GCTTTGTCCG CGTGAATGTC AGTGGGCAGG GAGAGTTGCC TGATCATCGA ATCGCCGAGG 
0301 TGCTGGGCAT CTGCGAACTG GACTTTGGCT ACAAAGTGGA GCAGATACCC ACGAATGTGG 
0361 CGCTGCGATT GCGCTACGAT GACCTGGAGA TGCAGCACGA GATTAACGAT GTCTCTAACC 
0421 TGAACTTCAC CCAGGAGGAA TTCGAACTGT GGCGCGATAA CTGTGTTAAC CAGGCCATAA 
0481 GTCCACCCAC CACCCACATA  
 Assemble Data

12498R-3.IR_full       1   ACCAGCGATCCCGACACGTTCGTCGTCCGGCAGCGGAAATAGTCCGCGAACTGAGGAACC 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
12498R-3.in silico     1   ACCAGCGATCCCGACACGTTCGTCGTCCGGCAGCGGAAATAGTCCGCGAACTGAGGAATC 60


12498R-3.IR_full       61  TTCGCGCCTCGCCTCTGCGGATCGACGACGAGAACGAGTCGTGGGTGAATGGCTACGAGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12498R-3.in silico     61  TTCGCGCCTCGCCTCTGCGGATCGACGACGAGAACGAGTCGTGGGTGAATGGCTACGAGA 120


12498R-3.IR_full       121 AGCCACCAACTCCGGATCTACCGGTGACCAGTCGCGATCAGTTGGAGCTGCTACGTCTGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12498R-3.in silico     121 AGCCACCAACTCCGGATCTACCGGTGACCAGTCGCGATCAGTTGGAGCTGCTACGTCTGA 180


12498R-3.IR_full       181 GCCGCCATCGAATCGGTCTGCTTCTGGTTCGACCCGCCTTCGAGCAGGCCGTCACTGGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12498R-3.in silico     181 GCCGCCATCGAATCGGTCTGCTTCTGGTTCGACCCGCCTTCGAGCAGGCCGTCACTGGAT 240


12498R-3.IR_full       241 GCTTTGTCCGCGTGAATGTCAGTGGGCAGGGAGAGTTGCCTGATCATCGAATCGCCGAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12498R-3.in silico     241 GCTTTGTCCGCGTGAATGTCAGTGGGCAGGGAGAGTTGCCTGATCATCGAATCGCCGAGG 300


12498R-3.IR_full       301 TGCTGGGCATCTGCGAACTGGACTTTGGCTACAAAGTGGAGCAGATACCCACGAATGTGN 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
12498R-3.in silico     301 TGCTGGGCATCTGCGAACTGGACTTTGGCTACAAAGTGGAGCAGATACCCACGAATGTGG 360


12498R-3.IR_full       361 CGCTGCGATTGCGCTACGATGACCTGGAGATGCAGCACGAGATTAACGATGTCTCTAACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12498R-3.in silico     361 CGCTGCGATTGCGCTACGATGACCTGGAGATGCAGCACGAGATTAACGATGTCTCTAACC 420


12498R-3.IR_full       421 TGAACTTCACCCAGGAGGAATTCGAACTGTGGCGCGATAACTGTGTTAACCAGGCCATAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12498R-3.in silico     421 TGAACTTCACCCAGGAGGAATTCGAACTGTGGCGCGATAACTGTGTTAACCAGGCCATAA 480


12498R-3.IR_full       481 GTCCACCCACCACCCACATA 500
                           ||||||||||||||||||||
12498R-3.in silico     481 GTCCACCCACCACCCACATA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130674.1  CG12498-RA (CG12498), mRNA 
0   NM_058090.2  CG7121-RA (Tehao), mRNA 
0   NM_170635.1  CG32171-RD, transcript variant D (Lmpt), mRNA 
0   NM_206387.1  CG32171-RH, transcript variant H (Lmpt), mRNA 
0   NM_206388.1  CG32171-RG, transcript variant G (Lmpt), mRNA 
0   NM_140673.3  CG32171-RB, transcript variant B (Lmpt), mRNA 
0   NM_167581.2  CG7826-RA, transcript variant A (mnb), mRNA 
0   NM_170658.2  CG7826-RC, transcript variant C (mnb), mRNA 
0   NM_001014750.1  CG7826-RD, transcript variant D (mnb), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_165842.1  CG10897-RC, transcript variant C (tou), mRNA 
0   NM_140928.2  CG32223-RA (CG32223), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   NM_057883.2  CG10117-RA (ttv), mRNA 
0   NM_079507.2  CG2530-RA (corto), mRNA 
0   NM_001043277.1  CG31163-RD, transcript variant D (CG31163), mRNA 
0   NM_169997.3  CG31163-RB, transcript variant B (CG31163), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_134603.1  CG1489-RA (Pros45), mRNA 
0   NM_142761.1  CG13859-RA (CG13859), mRNA 
0   NM_134495.2  CG12234-RA (Ranbp21), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_176099.1  CG33140-RA (CG33140), mRNA 
0   NM_079742.2  CG5212-RA (Pli), mRNA 
0   NM_079917.2  CG18296-RA (axo), mRNA 
0   NM_132536.1  CG1840-RA (CG1840), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_139795.1  CG10124-RA (eIF4E-4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.