National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1241R-3 
 Symbol Atg2  Full Name Autophagy-specific gene 2 
 CG No CG1241  Old CG No CG1241 
 Synonyms ATG2, unnamed, CG1241, EP3697, Atg2 
 Accession No (Link to NCBI) NM_139491.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCTTCCAGGCCAGCCATGTG 
 Primer Seq. 3'
aatctagaggtaccAGAATCCCCGTCATCCGGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCTTCCAGG CCAGCCATGT GGAGTATAAG AACAAGACGG GCTACGAGAT GCCCATGTCC 
0061 ACCTCCCAGG ACACTGAAAC CGAAGAAGAT CCCAATAGCA GCTTCAATGC ACTGCCCATG 
0121 ATAGCCAAGC ACAATTTGGT GATCGAGGGA CTTAGTTTGC ACACCTCCGA AGTGCTTGAT 
0181 GTGATGGATC ACCCAGTTTG GACCCACTCC CTACGAGCAG CTCTGCAAGA TTGTGGAGCT 
0241 CAAGGGCGCG CAAAACATCC AGATCAACAT CAAGCAGACG GAAAATATAG TGGGGCCCAA 
0301 GGTCAGCCTA GAACTGAGTC TGGACGACAT ATACTTNCAT GCTAACGCCG CGTCAAATTC 
0361 ACCTGCTCAT CGAGTTCTCC AAGGGCTTCA ACTGCGGCGG TCAGCAGGAG CGACCCAAAA 
0421 AGGGCAGAAG CTTGAANAAT CGGCTCCGcC CAGTGAGTAT CACATGCAAA GTCTGCAGCA 
0481 GCCCACCCGG ATGACGGGGA TTCT 
 in silico PCR Fragment
0001 TCCTTCCAGG CCAGCCATGT GGAGTATAAG AACAAGACGG GCTACGAGAT GCCCATGTCC 
0061 ACCTCCCAGG ACACTGAAAC CGAAGAAGAT CCCAATAGCA GCTTCAATGC ACTGCCCATG 
0121 ATAGCCAAGC ACAATTTGGT GATCGAGGGA CTTAGTTTGC ACACCTCCGA AGTGCTTGAT 
0181 GTGATGGATC A-CCAGTTTG GACCCACTCC CTACGAGCAG CTCTGCAAGA TTGTGGAGCT 
0241 CAAGGGCGCG CAAAACATCC AGATCAACAT CAAGCAGACG GAAAATATAG TGGGGCCCAA 
0301 GGTCAGCCTA GAACTGAGTC TGGACGACAT ATACTT-CAT GCTAACGCCG CGTCAAATTC 
0361 ACCTGCTCAT CGAGTTCTCA AAGGGCTTCA ACTGCGGCGG TCAGCAGGAG CGACCCAAAA 
0421 AGGGCAGAAG CTTGA--AAT CGGCTCCGCC CAGTGAGTAT CAGATGCACA GTTTGCAGCA 
0481 GCCCACCCGG ATGACGGGGA TTCT 
 Assemble Data

1241R-3.IR_full       1   TCCTTCCAGGCCAGCCATGTGGAGTATAAGAACAAGACGGGCTACGAGATGCCCATGTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1241R-3.in silico     1   TCCTTCCAGGCCAGCCATGTGGAGTATAAGAACAAGACGGGCTACGAGATGCCCATGTCC 60


1241R-3.IR_full       61  ACCTCCCAGGACACTGAAACCGAAGAAGATCCCAATAGCAGCTTCAATGCACTGCCCATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1241R-3.in silico     61  ACCTCCCAGGACACTGAAACCGAAGAAGATCCCAATAGCAGCTTCAATGCACTGCCCATG 120


1241R-3.IR_full       121 ATAGCCAAGCACAATTTGGTGATCGAGGGACTTAGTTTGCACACCTCCGAAGTGCTTGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1241R-3.in silico     121 ATAGCCAAGCACAATTTGGTGATCGAGGGACTTAGTTTGCACACCTCCGAAGTGCTTGAT 180


1241R-3.IR_full       181 GTGATGGATCACCCAGTTTGGACCCACTCCCTACGAGCAGCTCTGCAAGATTGTGGAGCT 240
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
1241R-3.in silico     181 GTGATGGATCA-CCAGTTTGGACCCACTCCCTACGAGCAGCTCTGCAAGATTGTGGAGCT 240


1241R-3.IR_full       241 CAAGGGCGCGCAAAACATCCAGATCAACATCAAGCAGACGGAAAATATAGTGGGGCCCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1241R-3.in silico     241 CAAGGGCGCGCAAAACATCCAGATCAACATCAAGCAGACGGAAAATATAGTGGGGCCCAA 300


1241R-3.IR_full       301 GGTCAGCCTAGAACTGAGTCTGGACGACATATACTTNCATGCTAACGCCGCGTCAAATTC 360
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1241R-3.in silico     301 GGTCAGCCTAGAACTGAGTCTGGACGACATATACTT-CATGCTAACGCCGCGTCAAATTC 360


1241R-3.IR_full       361 ACCTGCTCATCGAGTTCTCCAAGGGCTTCAACTGCGGCGGTCAGCAGGAGCGACCCAAAA 420
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
1241R-3.in silico     361 ACCTGCTCATCGAGTTCTCAAAGGGCTTCAACTGCGGCGGTCAGCAGGAGCGACCCAAAA 420


1241R-3.IR_full       421 AGGGCAGAAGCTTGAANAATCGGCTCCGCCCAGTGAGTATCACATGCAAAGTCTGCAGCA 480
                          |||||||||||||||  ||||||||||||||||||||||||| ||||| ||| |||||||
1241R-3.in silico     421 AGGGCAGAAGCTTGA--AATCGGCTCCGCCCAGTGAGTATCAGATGCACAGTTTGCAGCA 480


1241R-3.IR_full       481 GCCCACCCGGATGACGGGGATTCT 504
                          ||||||||||||||||||||||||
1241R-3.in silico     481 GCCCACCCGGATGACGGGGATTCT 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139491.1  CG1241-RA (Atg2), mRNA 
0   NM_170323.1  CG31063-RA (CG31063), mRNA 
0   15  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_130624.2  CG16903-RA (CG16903), mRNA 
0   NM_141885.2  CG3132-RA (Ect3), mRNA 
0   NM_167303.1  CG4139-RA, transcript variant A (Karl), mRNA 
0   NM_132520.2  CG4139-RB, transcript variant B (Karl), mRNA 
0   NM_140814.1  CG3893-RA (CG3893), mRNA 
0   NM_167627.1  CG6659-RB, transcript variant B (CG6659), mRNA 
0   NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_141504.1  CG2747-RA, transcript variant A (CG2747), mRNA 
0   NM_169205.1  CG2747-RB, transcript variant B (CG2747), mRNA 
0   NM_132062.1  CG5921-RB, transcript variant B (CG5921), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_140559.1  CG17033-RA (CG17033), mRNA 
0   NM_170278.1  CG31082-RA (CG31082), mRNA 
0   NM_132212.2  CG1575-RA (CG1575), mRNA 
0   NM_142739.2  CG6678-RA (CG6678), mRNA 
0   NM_134929.2  CG3254-RA (pgant2), mRNA 
0   NM_140277.1  CG17824-RA (CG17824), mRNA 
0   NM_169676.1  CG31150-RA (CG31150), mRNA 
0   NM_135750.1  CG16800-RA (CG16800), mRNA 
0   NM_170406.1  CG11956-RC, transcript variant C (SP1029), mRNA 
0   NM_144361.1  CG11956-RA, transcript variant A (SP1029), mRNA 
0   NM_170405.1  CG11956-RB, transcript variant B (SP1029), mRNA 
0   NM_143135.1  CG11913-RA (CG11913), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_136834.1  CG13204-RA, transcript variant A (CG13204), mRNA 
0   NM_132050.1  CG3011-RA (CG3011), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.