National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1240R-3 
 Symbol CG1240  Full Name CG1240 
 CG No CG1240  Old CG No CG1240 
 Synonyms CG1240 
 Accession No (Link to NCBI) NM_139488.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACATCTCCAGCGAGGACCTGC 
 Primer Seq. 3'
aatctagaggtaccGCCGCCTTGGCCTTCTTCTTG 
 Predicted Fragment Size
460 
 IR fragment full Seq
0001 ACATCTCCAG CGAGGACCTG CGTCGTGAAA TTCAGGCGGT TCTGAAGGAC GCCGATTTGG 
0061 CGACCATTTC GGCAAAGAGG GTGCGCGAGC AGGTGGAGGG AAAGCTGAAC TGCTCGTTGC 
0121 TGAGCCGCAA GAAGGAATTC GACAAGATCG TGATGGAGGT GATCAACGAG CAGCAGGACG 
0181 AGGAGGACGA AGACGATGAC GAGGGCAAGG ATCCCGATGC CGATCCCGAC GATGAGAGCG 
0241 AGCCCAGCGA GGNAGGAGGA CCCCAGCAGC AGCGANGGAG GAGGCCGCCA AGAAGAAGAA 
0301 GCAGAGCCCC AAGAAGAGGC CACAGCCCAC GAAGCACAAG GCGCCCAAGA AGAAGCGCAA 
0361 GACCCTAAAT GCCGACGATT CCGGCACCGA GAGCGATGCC GGCTCGGACT CGGACTACGA 
0421 GGTGGTCAAG AAGCCGGCgG NCAAGAAGAA GGCCAAGGCG GC 
 in silico PCR Fragment
0001 ACATCTCCAG CGAGGACCTG CGTCGTGAAA TTCAGGCGGT TCTGAAGGAC GCCGATTTGG 
0061 CGACCATTTC GGCAAAGAGG GTGCGCGAGC AGGTGGAGGG AAAGCTGAAC TGCTCGTTGC 
0121 TGAGCCGCAA GAAGGAGTTC GACAAGATCG TGATGGAGGT GATCAACGAG CAGCAGGACG 
0181 AGGAGGACGA AGACGATGAC GAGGGCAAGG ATCCCGATGC CGATCCCGAC GATGAGAGCG 
0241 AGCCCAGCGA GG-AGGAGGA CCCCAGCAGC AGCGA-GGAG GAGGCCGCCA AGAAGAAGAA 
0301 GCAGAGCCCC AAGAAGAGGC CACAGCCCAC GAAGCACAAG GCGCCCAAGA AGAAGCGCAA 
0361 GACCCTAAAT GCCGACGATT CCGGCACCGA GAGCGATGCC GGCTCGGACT CGGACTACGA 
0421 GGTGGTCAAG AAGCCGGCGG CCAAGAAGAA GGCCAAGGCG GC 
 Assemble Data

1240R-3.IR_full       1   ACATCTCCAGCGAGGACCTGCGTCGTGAAATTCAGGCGGTTCTGAAGGACGCCGATTTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1240R-3.in silico     1   ACATCTCCAGCGAGGACCTGCGTCGTGAAATTCAGGCGGTTCTGAAGGACGCCGATTTGG 60


1240R-3.IR_full       61  CGACCATTTCGGCAAAGAGGGTGCGCGAGCAGGTGGAGGGAAAGCTGAACTGCTCGTTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1240R-3.in silico     61  CGACCATTTCGGCAAAGAGGGTGCGCGAGCAGGTGGAGGGAAAGCTGAACTGCTCGTTGC 120


1240R-3.IR_full       121 TGAGCCGCAAGAAGGAATTCGACAAGATCGTGATGGAGGTGATCAACGAGCAGCAGGACG 180
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
1240R-3.in silico     121 TGAGCCGCAAGAAGGAGTTCGACAAGATCGTGATGGAGGTGATCAACGAGCAGCAGGACG 180


1240R-3.IR_full       181 AGGAGGACGAAGACGATGACGAGGGCAAGGATCCCGATGCCGATCCCGACGATGAGAGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1240R-3.in silico     181 AGGAGGACGAAGACGATGACGAGGGCAAGGATCCCGATGCCGATCCCGACGATGAGAGCG 240


1240R-3.IR_full       241 AGCCCAGCGAGGNAGGAGGACCCCAGCAGCAGCGANGGAGGAGGCCGCCAAGAAGAAGAA 300
                          |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||
1240R-3.in silico     241 AGCCCAGCGAGG-AGGAGGACCCCAGCAGCAGCGA-GGAGGAGGCCGCCAAGAAGAAGAA 300


1240R-3.IR_full       301 GCAGAGCCCCAAGAAGAGGCCACAGCCCACGAAGCACAAGGCGCCCAAGAAGAAGCGCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1240R-3.in silico     301 GCAGAGCCCCAAGAAGAGGCCACAGCCCACGAAGCACAAGGCGCCCAAGAAGAAGCGCAA 360


1240R-3.IR_full       361 GACCCTAAATGCCGACGATTCCGGCACCGAGAGCGATGCCGGCTCGGACTCGGACTACGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1240R-3.in silico     361 GACCCTAAATGCCGACGATTCCGGCACCGAGAGCGATGCCGGCTCGGACTCGGACTACGA 420


1240R-3.IR_full       421 GGTGGTCAAGAAGCCGGCGGNCAAGAAGAAGGCCAAGGCGGC 462
                          |||||||||||||||||||| |||||||||||||||||||||
1240R-3.in silico     421 GGTGGTCAAGAAGCCGGCGGCCAAGAAGAAGGCCAAGGCGGC 462

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   442  18  NM_139488.2  CG1240-RA (CG1240), mRNA 
1.13   NM_141762.2  CG14692-RA (CG14692), mRNA 
0.9   NM_080103.2  CG1922-RA (onecut), mRNA 
0.45   NM_164412.1  CG5450-RB, transcript variant B (Cdlc2), mRNA 
0.45   NM_058060.3  CG5450-RA, transcript variant A (Cdlc2), mRNA 
0.45   NM_205888.1  CG4629-RC, transcript variant C (CG4629), mRNA 
0.45   NM_164404.2  CG4629-RB, transcript variant B (CG4629), mRNA 
0.45   NM_134720.2  CG4629-RA, transcript variant A (CG4629), mRNA 
0.45   NM_139621.1  CG1265-RB (CG1265), mRNA 
0.22   NM_078577.2  CG4147-RB, transcript variant B (Hsc70-3), mRNA 
0.22   NM_167308.1  CG4147-RD, transcript variant D (Hsc70-3), mRNA 
0.22   NM_167306.1  CG4147-RA, transcript variant A (Hsc70-3), mRNA 
0.22   NM_167307.1  CG4147-RC, transcript variant C (Hsc70-3), mRNA 
0.22   13  NM_133148.2  CG8034-RA (CG8034), mRNA 
0.22   NM_142792.3  CG7057-RB, transcript variant B (AP-50), mRNA 
0.22   NM_170015.1  CG7057-RA, transcript variant A (AP-50), mRNA 
0.22   NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
0   14  NM_057442.3  CG15288-RA, transcript variant A (wb), mRNA 
0   14  NM_165086.1  CG15288-RB, transcript variant B (wb), mRNA 
0   13  NM_141223.1  CG14652-RA (CG14652), mRNA 
0   20  33  NM_167015.2  CG6998-RC, transcript variant C (ctp), mRNA 
0   20  33  NM_080336.3  CG6998-RA, transcript variant A (ctp), mRNA 
0   20  33  NM_167016.1  CG6998-RD, transcript variant D (ctp), mRNA 
0   20  33  NM_167014.1  CG6998-RB, transcript variant B (ctp), mRNA 
0   16  NM_141239.1  CG17735-RA (CG17735), mRNA 
0   11  NM_132503.2  CG11696-RA (CG11696), mRNA 
0   NM_079289.2  CG10574-RA (I-2), mRNA 
0   33  64  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   52  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   16  NM_140412.1  CG8833-RA (CG8833), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.