National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12397R-3 
 Symbol debcl  Full Name death executioner Bcl-2 homologue 
 CG No CG33134  Old CG No CG12397 
 Synonyms debcl/Borg1, borg1/debcl, Drob-1/Debcl/dBorg-1/dBok, Bok(Debcl), Debcl/Drob-1/dBorg-1/dBok, Drob-1, Debcl, Bok, dBOK, Debcl/dBorg-1/dRob-1, Dbok, dBorg01, CG12397, drob-1, debok, dBORG-1/DROB-1/DEBCL/dBOK, dBorg1, dBorg-1, DEBCL, Drob-1/Debcl/dBORG-1, Drob-1/Debcl/dBorg-1/DBok, DBok, dbok, BOK, BG1, dborg1, CG33134, debcl, Debcl/dBorg-1/dBok/Drob-1 
 Accession No (Link to NCBI) NM_176098.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     1   GCTGGCCAAGTTCAAGTCCTCGTCGCTGGACCACGAGATC-TACACGGCCAATCGCCGCG 60

                           |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| silico     61  GCACCATTGCCACGGCCTCCAGCGACTGGAAGGCGC-TCCGCGGAGGCGTCGGTGGAGGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCAGGAGGACCCGGTAGCGTACCCAATCCCTCTAACGGACGCTCCCTTCACGCCGGCGGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCATGACACGGGCCGCCTCCACATCCTCGCTGGCTAGCAGTACGCGCACGATGACTAAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TACCAGGAGTACAAAATGGATATCATCAACCAGGGGAAATGTCTGTGTGGTCAGTACATC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGAGCGCGGCTGCGACGGGCAGGAGTCCTCAACCGGAAGGTGACACAGCGTTTGCGCAAC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATCCTGGACCCCGGCTCCTCGCACGTGGTCTATGAAGTTTTCCCGGCACTGAACAGCATG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCGAGGAACTGGAGCGGATGCACCCGCGGGTGTACACAAACATATCGCGACAGCTGTCG 480

                           |||||||||||||||||||||||||||| silico     481 AGGGCCCCGTTTGGCGAGCTGGAGGACA 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   488  NM_176098.1  CG33134-RA (debcl), mRNA 
0.4   NM_132781.1  CG5662-RA (CG5662), mRNA 
0.2   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0.2   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_142878.2  CG6755-RB, transcript variant B (EloA), mRNA 
0   NM_170061.1  CG6755-RA, transcript variant A (EloA), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_168080.1  CG32251-RA (CG32251), mRNA 
0   NM_170506.1  CG1539-RC, transcript variant C (tmod), mRNA 
0   NM_134892.2  CG17264-RA (CG17264), mRNA 
0   NM_143319.2  CG12275-RA (RpS10a), mRNA 
0   NM_141374.1  CG1154-RA (Osi12), mRNA 
0   NM_143436.1  CG2006-RA (CG2006), mRNA 
0   10  23  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_078978.1  CG8238-RA (Buffy), mRNA 
0   10  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   NM_167625.1  CG6500-RA, transcript variant A (Bx), mRNA 
0   NM_176758.1  CG6500-RC, transcript variant C (Bx), mRNA 
0   NM_078678.2  CG6500-RB, transcript variant B (Bx), mRNA 
0   15  NM_139645.2  CG15021-RA (CG15021), mRNA 
0   NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_167916.2  CG32315-RA (dlt), mRNA 
0   NM_139503.1  CG2162-RA (CG2162), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.