National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12397R-2 
 Symbol debcl  Full Name death executioner Bcl-2 homologue 
 CG No CG33134  Old CG No CG12397 
 Synonyms debcl/Borg1, borg1/debcl, Drob-1/Debcl/dBorg-1/dBok, Bok(Debcl), Debcl/Drob-1/dBorg-1/dBok, Drob-1, Debcl, Bok, dBOK, Debcl/dBorg-1/dRob-1, Dbok, dBorg01, CG12397, drob-1, debok, dBORG-1/DROB-1/DEBCL/dBOK, dBorg1, dBorg-1, DEBCL, Drob-1/Debcl/dBORG-1, Drob-1/Debcl/dBorg-1/DBok, DBok, dbok, BOK, BG1, dborg1, CG33134, debcl, Debcl/dBorg-1/dBok/Drob-1 
 Accession No (Link to NCBI) NM_176098.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGGCCAAGTTCAAGTCCTC 
 Primer Seq. 3'
aatctagaggtaccTGTCCTCCAGCTCGCCAAACG 
 Predicted Fragment Size
506 
 IR fragment full Seq
0001 GCTGGCCAAG TTCAAGTCCT CGTCGCTGGA CCACGAGATC TTACACGGCC AATCGCCGCG 
0061 GCACCATTGC AACGGCCTCC AGCGACTGGA AGgcGCGTCC GCGGAGGCGT CGGTGGAGGA 
0121 GCAGGAGGAC CCGGTAGCGT ACCCAATCCC TCTAACGGAC GCTCCCTTCA CGCCGGCGGA 
0181 CCCATGACAC GGGCCGCCTC CACATCCTCG CTGGCTAGCA GTACGCGCAC GATGACTAAC 
0241 TACCAGGAGT ACAAAATGGA TATCATCAAC CAGGGGAAAT GTCTGTGTGG TCAGTACATC 
0301 AGAGCGCGGC TGCGACGGGC AGGAGTCCTC AACCGGAAGG TGACACAGCG TTTGCGCAAC 
0361 ATCCTGGACC CCGGCTCCTC GCACGTGGTC TATGAAGTTT TCCCGGCACT GAACAGCATG 
0421 GGCGAGGAAC TGGAGCGGAT GCACCCGCGG GTGTACACAA ACATATCGCG ACAGCTGTCG 
0481 AGGGCCCCGT TTGGCGAGCT GGAGGACA 
 in silico PCR Fragment
0001 GCTGGCCAAG TTCAAGTCCT CGTCGCTGGA CCACGAGATC -TACACGGCC AATCGCCGCG 
0061 GCACCATTGC CACGGCCTCC AGCGACTGGA AGGCGC-TCC GCGGAGGCGT CGGTGGAGGA 
0121 GCAGGAGGAC CCGGTAGCGT ACCCAATCCC TCTAACGGAC GCTCCCTTCA CGCCGGCGGA 
0181 CCCATGACAC GGGCCGCCTC CACATCCTCG CTGGCTAGCA GTACGCGCAC GATGACTAAC 
0241 TACCAGGAGT ACAAAATGGA TATCATCAAC CAGGGGAAAT GTCTGTGTGG TCAGTACATC 
0301 AGAGCGCGGC TGCGACGGGC AGGAGTCCTC AACCGGAAGG TGACACAGCG TTTGCGCAAC 
0361 ATCCTGGACC CCGGCTCCTC GCACGTGGTC TATGAAGTTT TCCCGGCACT GAACAGCATG 
0421 GGCGAGGAAC TGGAGCGGAT GCACCCGCGG GTGTACACAA ACATATCGCG ACAGCTGTCG 
0481 AGGGCCCCGT TTGGCGAGCT GGAGGACA 
 Assemble Data

12397R-2.IR_full       1   GCTGGCCAAGTTCAAGTCCTCGTCGCTGGACCACGAGATCTTACACGGCCAATCGCCGCG 60
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
12397R-2.in silico     1   GCTGGCCAAGTTCAAGTCCTCGTCGCTGGACCACGAGATC-TACACGGCCAATCGCCGCG 60


12397R-2.IR_full       61  GCACCATTGCAACGGCCTCCAGCGACTGGAAGGCGCGTCCGCGGAGGCGTCGGTGGAGGA 120
                           |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||
12397R-2.in silico     61  GCACCATTGCCACGGCCTCCAGCGACTGGAAGGCGC-TCCGCGGAGGCGTCGGTGGAGGA 120


12397R-2.IR_full       121 GCAGGAGGACCCGGTAGCGTACCCAATCCCTCTAACGGACGCTCCCTTCACGCCGGCGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12397R-2.in silico     121 GCAGGAGGACCCGGTAGCGTACCCAATCCCTCTAACGGACGCTCCCTTCACGCCGGCGGA 180


12397R-2.IR_full       181 CCCATGACACGGGCCGCCTCCACATCCTCGCTGGCTAGCAGTACGCGCACGATGACTAAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12397R-2.in silico     181 CCCATGACACGGGCCGCCTCCACATCCTCGCTGGCTAGCAGTACGCGCACGATGACTAAC 240


12397R-2.IR_full       241 TACCAGGAGTACAAAATGGATATCATCAACCAGGGGAAATGTCTGTGTGGTCAGTACATC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12397R-2.in silico     241 TACCAGGAGTACAAAATGGATATCATCAACCAGGGGAAATGTCTGTGTGGTCAGTACATC 300


12397R-2.IR_full       301 AGAGCGCGGCTGCGACGGGCAGGAGTCCTCAACCGGAAGGTGACACAGCGTTTGCGCAAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12397R-2.in silico     301 AGAGCGCGGCTGCGACGGGCAGGAGTCCTCAACCGGAAGGTGACACAGCGTTTGCGCAAC 360


12397R-2.IR_full       361 ATCCTGGACCCCGGCTCCTCGCACGTGGTCTATGAAGTTTTCCCGGCACTGAACAGCATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12397R-2.in silico     361 ATCCTGGACCCCGGCTCCTCGCACGTGGTCTATGAAGTTTTCCCGGCACTGAACAGCATG 420


12397R-2.IR_full       421 GGCGAGGAACTGGAGCGGATGCACCCGCGGGTGTACACAAACATATCGCGACAGCTGTCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12397R-2.in silico     421 GGCGAGGAACTGGAGCGGATGCACCCGCGGGTGTACACAAACATATCGCGACAGCTGTCG 480


12397R-2.IR_full       481 AGGGCCCCGTTTGGCGAGCTGGAGGACA 508
                           ||||||||||||||||||||||||||||
12397R-2.in silico     481 AGGGCCCCGTTTGGCGAGCTGGAGGACA 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   488  NM_176098.1  CG33134-RA (debcl), mRNA 
0.4   NM_132781.1  CG5662-RA (CG5662), mRNA 
0.2   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0.2   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_142878.2  CG6755-RB, transcript variant B (EloA), mRNA 
0   NM_170061.1  CG6755-RA, transcript variant A (EloA), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_168080.1  CG32251-RA (CG32251), mRNA 
0   NM_170506.1  CG1539-RC, transcript variant C (tmod), mRNA 
0   NM_134892.2  CG17264-RA (CG17264), mRNA 
0   NM_143319.2  CG12275-RA (RpS10a), mRNA 
0   NM_141374.1  CG1154-RA (Osi12), mRNA 
0   NM_143436.1  CG2006-RA (CG2006), mRNA 
0   10  23  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_078978.1  CG8238-RA (Buffy), mRNA 
0   10  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   NM_167625.1  CG6500-RA, transcript variant A (Bx), mRNA 
0   NM_176758.1  CG6500-RC, transcript variant C (Bx), mRNA 
0   NM_078678.2  CG6500-RB, transcript variant B (Bx), mRNA 
0   15  NM_139645.2  CG15021-RA (CG15021), mRNA 
0   NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_167916.2  CG32315-RA (dlt), mRNA 
0   NM_139503.1  CG2162-RA (CG2162), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.