National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12393R-3 
 Symbol CG12393  Full Name CG12393 
 CG No CG12393  Old CG No CG12393 
 Synonyms CG12393 
 Accession No (Link to NCBI) NM_135140.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAGAACCTGTACGTGTTCGC 
 Primer Seq. 3'
aatctagaggtaccAACTGTCTGGTGGAGGAGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAAGAACCTG TACGTGTTCG CGAGAACGCC GCCCTTCGAC ATGGAAGGCT TCCTCAACAA 
0061 ACGGGGCGAG GTCAACAAGG CCTTCCAGCG ACGCTACTTC GTGCTGAAAG GCAACCTGCT 
0121 CTTCTACTTC GAGTCGCGCT TGGACAAGGA GCCCTTGGGC CTCATCATTG TCGAGGGCTG 
0181 CACCATTGAG CTGTCTAACG AGGTGGACAA CTACTGCTTC GAGATCGCAT TCAACGGCAA 
0241 TCGCACCTAC ATCCTCGCCG CCGACAACCA AGACAGCATG GAGACGTGGA TGAAGGCGCT 
0301 AACATGCGCC GGCTACGAGT ATAAGCGCAT CATCCTGGCC GAGCTAAAAC GCCAGTTGCA 
0361 AGAGATGGAG GACGCAAGAA ACAAGATGCT CGGCAGCGCC TTGGACGGAC CACAAAATGC 
0421 ATCGGAGAGT GCGAAGCCTA GACCGCCGCC CAGGCGGACA AATCCATTCA ACAGACCCGC 
0481 TCCTCCTCCA CCAGACAGTT  
 in silico PCR Fragment
0001 GAAGAACCTG TACGTGTTCG CGAGAACGCC GCCCTTCGAC ATGGAAGGCT TCCTCAACAA 
0061 ACGGGGCGAG GTCAACAAGG CCTTCCAGCG ACGCTACTTC GTGCTGAAAG GCAACCTGCT 
0121 CTTCTACTTC GAGTCGCGCT TGGACAAGGA GCCCTTGGGC CTCATCATTG TCGAGGGCTG 
0181 CACCATTGAG CTGTCTAACG AGGTGGACAA CTACTGCTTC GAGATCGCCT TCAACGGCAA 
0241 TCGCACCTAC ATCCTCGCCG CCGAAAACCA AGACAGCATG GAGACGTGGA TGAAGGCGCT 
0301 AACATGCGCC GGCTACGAGT ATAAGCGCAT CATCCTGGCC GAGCTAAAAC GCCAGTTGCA 
0361 AGAGATGGAG GACGCAAGAA ACAAGATGCT CGGCAGCGCC TTGGACGGAC CACAAAATGC 
0421 ATCGGAGAGT GCGAAGCCTA GACCGCCGCC CAGGCGGACA AATCCATTCA ACAGACCCGC 
0481 TCCTCCTCCA CCAGACAGTT  
 Assemble Data

12393R-3.IR_full       1   GAAGAACCTGTACGTGTTCGCGAGAACGCCGCCCTTCGACATGGAAGGCTTCCTCAACAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12393R-3.in silico     1   GAAGAACCTGTACGTGTTCGCGAGAACGCCGCCCTTCGACATGGAAGGCTTCCTCAACAA 60


12393R-3.IR_full       61  ACGGGGCGAGGTCAACAAGGCCTTCCAGCGACGCTACTTCGTGCTGAAAGGCAACCTGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12393R-3.in silico     61  ACGGGGCGAGGTCAACAAGGCCTTCCAGCGACGCTACTTCGTGCTGAAAGGCAACCTGCT 120


12393R-3.IR_full       121 CTTCTACTTCGAGTCGCGCTTGGACAAGGAGCCCTTGGGCCTCATCATTGTCGAGGGCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12393R-3.in silico     121 CTTCTACTTCGAGTCGCGCTTGGACAAGGAGCCCTTGGGCCTCATCATTGTCGAGGGCTG 180


12393R-3.IR_full       181 CACCATTGAGCTGTCTAACGAGGTGGACAACTACTGCTTCGAGATCGCATTCAACGGCAA 240
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
12393R-3.in silico     181 CACCATTGAGCTGTCTAACGAGGTGGACAACTACTGCTTCGAGATCGCCTTCAACGGCAA 240


12393R-3.IR_full       241 TCGCACCTACATCCTCGCCGCCGACAACCAAGACAGCATGGAGACGTGGATGAAGGCGCT 300
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
12393R-3.in silico     241 TCGCACCTACATCCTCGCCGCCGAAAACCAAGACAGCATGGAGACGTGGATGAAGGCGCT 300


12393R-3.IR_full       301 AACATGCGCCGGCTACGAGTATAAGCGCATCATCCTGGCCGAGCTAAAACGCCAGTTGCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12393R-3.in silico     301 AACATGCGCCGGCTACGAGTATAAGCGCATCATCCTGGCCGAGCTAAAACGCCAGTTGCA 360


12393R-3.IR_full       361 AGAGATGGAGGACGCAAGAAACAAGATGCTCGGCAGCGCCTTGGACGGACCACAAAATGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12393R-3.in silico     361 AGAGATGGAGGACGCAAGAAACAAGATGCTCGGCAGCGCCTTGGACGGACCACAAAATGC 420


12393R-3.IR_full       421 ATCGGAGAGTGCGAAGCCTAGACCGCCGCCCAGGCGGACAAATCCATTCAACAGACCCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12393R-3.in silico     421 ATCGGAGAGTGCGAAGCCTAGACCGCCGCCCAGGCGGACAAATCCATTCAACAGACCCGC 480


12393R-3.IR_full       481 TCCTCCTCCACCAGACAGTT 500
                           ||||||||||||||||||||
12393R-3.in silico     481 TCCTCCTCCACCAGACAGTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164678.1  CG12393-RB, transcript variant B (CG12393), mRNA 
100   482  NM_135140.2  CG12393-RA, transcript variant A (CG12393), mRNA 
0   NM_135042.2  CG14043-RA (CG14043), mRNA 
0   NM_136616.3  CG8057-RA, transcript variant A (CG8057), mRNA 
0   NM_132889.2  CG9917-RA (CG9917), mRNA 
0   NM_057857.4  CG8749-RA (snRNP70K), mRNA 
0   NM_165538.1  CG1600-RA, transcript variant A (CG1600), mRNA 
0   NM_136449.2  CG1600-RC, transcript variant C (CG1600), mRNA 
0   NM_165539.1  CG1600-RB, transcript variant B (CG1600), mRNA 
0   NM_142893.1  CG10177-RA (CG10177), mRNA 
0   NM_079089.2  CG3661-RA (RpL23), mRNA 
0   NM_001038986.1  CG1721-RC, transcript variant C (Pglym78), mRNA 
0   NM_079822.2  CG1721-RA, transcript variant A (Pglym78), mRNA 
0   NM_001038987.1  CG1721-RB, transcript variant B (Pglym78), mRNA 
0   NM_143764.1  CG18031-RA (CG18031), mRNA 
0   NM_058133.3  CG31426-RA (ligatin), mRNA 
0   NM_135948.2  CG5809-RA (CaBP1), mRNA 
0   NM_136158.2  CG10538-RA (CdGAPr), mRNA 
0   NM_132819.2  CG8105-RA (CG8105), mRNA 
0   NM_170051.1  CG31457-RB (CG31457), mRNA 
0   NM_139720.2  CG5150-RA (CG5150), mRNA 
0   NM_141155.2  CG11367-RA (CG11367), mRNA 
0   NM_169116.1  CG2017-RC, transcript variant C (CG2017), mRNA 
0   NM_169115.1  CG2017-RB, transcript variant B (CG2017), mRNA 
0   NM_169117.1  CG2017-RD, transcript variant D (CG2017), mRNA 
0   NM_141346.2  CG2017-RA, transcript variant A (CG2017), mRNA 
0   NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.