National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12393R-1 
 Symbol CG12393  Full Name CG12393 
 CG No CG12393  Old CG No CG12393 
 Synonyms CG12393 
 Accession No (Link to NCBI) NM_135140.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAAGAACCTGTACGTGTTCGCGAGAACGCCGCCCTTCGACATGGAAGGCTTCCTCAACAA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGGGGCGAGGTCAACAAGGCCTTCCAGCGACGCTACTTCGTGCTGAAAGGCAACCTGCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTTCTACTTCGAGTCGCGCTTGGACAAGGAGCCCTTGGGCCTCATCATTGTCGAGGGCTG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     181 CACCATTGAGCTGTCTAACGAGGTGGACAACTACTGCTTCGAGATCGCCTTCAACGGCAA 240

                           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     241 TCGCACCTACATCCTCGCCGCCGAAAACCAAGACAGCATGGAGACGTGGATGAAGGCGCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACATGCGCCGGCTACGAGTATAAGCGCATCATCCTGGCCGAGCTAAAACGCCAGTTGCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGAGATGGAGGACGCAAGAAACAAGATGCTCGGCAGCGCCTTGGACGGACCACAAAATGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCGGAGAGTGCGAAGCCTAGACCGCCGCCCAGGCGGACAAATCCATTCAACAGACCCGC 480

12393R-1.IR_full       481 TCCTCCTCCACCAGACAGTT 500
                           |||||||||||||||||||| silico     481 TCCTCCTCCACCAGACAGTT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164678.1  CG12393-RB, transcript variant B (CG12393), mRNA 
100   482  NM_135140.2  CG12393-RA, transcript variant A (CG12393), mRNA 
0   NM_135042.2  CG14043-RA (CG14043), mRNA 
0   NM_136616.3  CG8057-RA, transcript variant A (CG8057), mRNA 
0   NM_132889.2  CG9917-RA (CG9917), mRNA 
0   NM_057857.4  CG8749-RA (snRNP70K), mRNA 
0   NM_165538.1  CG1600-RA, transcript variant A (CG1600), mRNA 
0   NM_136449.2  CG1600-RC, transcript variant C (CG1600), mRNA 
0   NM_165539.1  CG1600-RB, transcript variant B (CG1600), mRNA 
0   NM_142893.1  CG10177-RA (CG10177), mRNA 
0   NM_079089.2  CG3661-RA (RpL23), mRNA 
0   NM_001038986.1  CG1721-RC, transcript variant C (Pglym78), mRNA 
0   NM_079822.2  CG1721-RA, transcript variant A (Pglym78), mRNA 
0   NM_001038987.1  CG1721-RB, transcript variant B (Pglym78), mRNA 
0   NM_143764.1  CG18031-RA (CG18031), mRNA 
0   NM_058133.3  CG31426-RA (ligatin), mRNA 
0   NM_135948.2  CG5809-RA (CaBP1), mRNA 
0   NM_136158.2  CG10538-RA (CdGAPr), mRNA 
0   NM_132819.2  CG8105-RA (CG8105), mRNA 
0   NM_170051.1  CG31457-RB (CG31457), mRNA 
0   NM_139720.2  CG5150-RA (CG5150), mRNA 
0   NM_141155.2  CG11367-RA (CG11367), mRNA 
0   NM_169116.1  CG2017-RC, transcript variant C (CG2017), mRNA 
0   NM_169115.1  CG2017-RB, transcript variant B (CG2017), mRNA 
0   NM_169117.1  CG2017-RD, transcript variant D (CG2017), mRNA 
0   NM_141346.2  CG2017-RA, transcript variant A (CG2017), mRNA 
0   NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.