National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12367R-1 
 Symbol CG12367  Full Name CG12367 
 CG No CG12367  Old CG No CG12367 
 Synonyms CG12367 
 Accession No (Link to NCBI) NM_136888.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGCGTTAATCCACTGGTTT 
 Primer Seq. 3'
aatctagaggtaccATTGGGTTTGCTAACCAACGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGCGTTAA TCCACTGGTT TCCGATTATA TACGGAGTCG CGCGAGTCCT CTAAAAGTTC 
0061 AAATTCTGCA GGGGAATGTG GCTGATTCTT CGGAAGAATT GAGGGACACC GACGCTGTAA 
0121 TCGCAATTTG AACTAATCGA GCACGTTTAC GACGATGTAT TGGCCAAAAT TCCAGTCAAC 
0181 ATTTTTGGTT TCATGCAGCC GAAATTGGTA GTCTTCAGCA CGCCAAACTC GGACTTCAAC 
0241 GTTATATTTA CGCGGTTCAA TCCGCTGTTG CCAAATGGTT TTCGCCACGA GGATCACAAG 
0301 TTCGAGTGGT CACGCGATGA GTTCAAGAAC TGGTGTTTGG GCATTGTGGA GAAGTACCCG 
0361 AATTATATGT TTTCCCTAAC GGGAGTGGGT AATCCGCCTA AGGAATACGA GTCGGTGGGC 
0421 CCCGTTTCAC AGATAGCCAT ATTCGTTCGC AAGGATATGC TGGAGATGCA GTTGGTTAAC 
0481 CCGTTGGTTA GCAAACCCAA GGT 
 in silico PCR Fragment
0001 CCAGCGTTAA TCCACTGGTT TCCGATTATA TACGGAGTCG CGCGAGTCCT CTAAAAGTTC 
0061 AAATTCTGCA GGGGAATGTG GCTGATTCTT CGGAAGAATT GAGGGACACT GACGCTGTAA 
0121 TCGCAA-TTG AACTAATCGA GCACGTTTAC GACGATGTAT TGGCCAAAAT TCCAGTCAAC 
0181 ATTTTTGGTT TCATGCAGCC GAAATTGGTA GTCTTCAGCA CACCAAACTC GGACTTCAAC 
0241 GTTATATTTA CGCGGTTCAA TCCGCTGTTG CCAAATGGTT TTCGCCACGA GGATCACAAG 
0301 TTCGAGTGGT CACGCGATGA GTTCAAGAAC TGGTGTTTGG GCATTGTGGA GAAGTACCCG 
0361 AATTATATGT TTTCCCTAAC GGGAGTGGGT AATCCGCCTA AGGAATACGA GTCGGTGGGC 
0421 CCCGTTTCAC AGATAGCCAT ATTCGTTCGC AAGGATATGC TGGAGATGCA GTTGGTTAAC 
0481 CCGTTGGTTA GCAAACCCAA --T 
 Assemble Data

12367R-1.IR_full       1   CCAGCGTTAATCCACTGGTTTCCGATTATATACGGAGTCGCGCGAGTCCTCTAAAAGTTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12367R-1.in silico     1   CCAGCGTTAATCCACTGGTTTCCGATTATATACGGAGTCGCGCGAGTCCTCTAAAAGTTC 60


12367R-1.IR_full       61  AAATTCTGCAGGGGAATGTGGCTGATTCTTCGGAAGAATTGAGGGACACCGACGCTGTAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
12367R-1.in silico     61  AAATTCTGCAGGGGAATGTGGCTGATTCTTCGGAAGAATTGAGGGACACTGACGCTGTAA 120


12367R-1.IR_full       121 TCGCAATTTGAACTAATCGAGCACGTTTACGACGATGTATTGGCCAAAATTCCAGTCAAC 180
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
12367R-1.in silico     121 TCGCAA-TTGAACTAATCGAGCACGTTTACGACGATGTATTGGCCAAAATTCCAGTCAAC 180


12367R-1.IR_full       181 ATTTTTGGTTTCATGCAGCCGAAATTGGTAGTCTTCAGCACGCCAAACTCGGACTTCAAC 240
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
12367R-1.in silico     181 ATTTTTGGTTTCATGCAGCCGAAATTGGTAGTCTTCAGCACACCAAACTCGGACTTCAAC 240


12367R-1.IR_full       241 GTTATATTTACGCGGTTCAATCCGCTGTTGCCAAATGGTTTTCGCCACGAGGATCACAAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12367R-1.in silico     241 GTTATATTTACGCGGTTCAATCCGCTGTTGCCAAATGGTTTTCGCCACGAGGATCACAAG 300


12367R-1.IR_full       301 TTCGAGTGGTCACGCGATGAGTTCAAGAACTGGTGTTTGGGCATTGTGGAGAAGTACCCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12367R-1.in silico     301 TTCGAGTGGTCACGCGATGAGTTCAAGAACTGGTGTTTGGGCATTGTGGAGAAGTACCCG 360


12367R-1.IR_full       361 AATTATATGTTTTCCCTAACGGGAGTGGGTAATCCGCCTAAGGAATACGAGTCGGTGGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12367R-1.in silico     361 AATTATATGTTTTCCCTAACGGGAGTGGGTAATCCGCCTAAGGAATACGAGTCGGTGGGC 420


12367R-1.IR_full       421 CCCGTTTCACAGATAGCCATATTCGTTCGCAAGGATATGCTGGAGATGCAGTTGGTTAAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12367R-1.in silico     421 CCCGTTTCACAGATAGCCATATTCGTTCGCAAGGATATGCTGGAGATGCAGTTGGTTAAC 480


12367R-1.IR_full       481 CCGTTGGTTAGCAAACCCAAGGT 503
                           ||||||||||||||||||||  |
12367R-1.in silico     481 CCGTTGGTTAGCAAACCCAA--T 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136888.2  CG12367-RA (CG12367), mRNA 
0.2   NM_135180.1  CG9511-RA (CG9511), mRNA 
0   NM_169389.2  CG5270-RB, transcript variant B (CG5270), mRNA 
0   NM_168551.1  CG32130-RA, transcript variant A (stv), mRNA 
0   NM_168553.1  CG32130-RB, transcript variant B (stv), mRNA 
0   NM_168552.1  CG32130-RC, transcript variant C (stv), mRNA 
0   NM_168554.1  CG32130-RD, transcript variant D (stv), mRNA 
0   NM_167104.1  CG4590-RB, transcript variant B (inx2), mRNA 
0   NM_132147.2  CG4590-RA, transcript variant A (inx2), mRNA 
0   NM_169994.1  CG31424-RA (CG31424), mRNA 
0   NM_079097.1  CG9820-RA (Or59a), mRNA 
0   NM_166619.1  CG5411-RC, transcript variant C (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_140723.1  CG12229-RA (CG12229), mRNA 
0   NM_140316.2  CG32104-RB (CG32104), mRNA 
0   NM_206644.1  CG15332-RB, transcript variant B (CG15332), mRNA 
0   NM_137795.1  CG6613-RA (CG6613), mRNA 
0   14  NM_137311.2  CG8566-RD (unc-104), mRNA 
0   NM_135602.2  CG6743-RA (Nup170), mRNA 
0   NM_137538.1  CG15100-RA (CG15100), mRNA 
0   NM_165903.1  CG30334-RA (CG30334), mRNA 
0   NM_169567.1  CG3050-RB, transcript variant B (Cyp6d5), mRNA 
0   NM_142070.2  CG3050-RA, transcript variant A (Cyp6d5), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_135841.4  CG8954-RA, transcript variant A (Smg5), mRNA 
0   NM_165069.1  CG8954-RB, transcript variant B (Smg5), mRNA 
0   NM_164890.1  CG4839-RB, transcript variant B (CG4839), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.