National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12289R-1 
 Symbol CG12289  Full Name CG12289 
 CG No CG12289  Old CG No CG12289 
 Synonyms BcDNA:AT04143, CG12289 
 Accession No (Link to NCBI) NM_140208.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCATGGATAAGGTCGACTTC 
 Primer Seq. 3'
aatctagaggtaccCACATGGCAATCAGATGCACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 aCCATGGAGT AAGGTCGACT TCCAGTGCGA CAGGTGCAGC ACCCAGAATG GAATGCTTCA 
0061 GCGCAGCGGA AGATCCTCGA ATGTTAGTAC GGCCCTGCGT CTGTTGGGCG CCAATGTGGA 
0121 GTTGTTCGGT GTGCTCACCC GTAATCCCAC CTATCGCATG ATTCTGGATG ATCTCGAGCA 
0181 GCGGGGCATT GATATTAGCC ATTGTACATT CACGGACGCA AGTCCTCCCT TTTCCACAAT 
0241 TGTCCAAGAT CGCTGGACGC GTCGTTGCAC GGTGGTGTAT TGCGACAAGT CATTTCCATA 
0301 TGTTACGGCA GCGGATTTTC GCAAACTGGA TCTCGATCAA TACGGCTGGG TGAATTTTGA 
0361 GGCACGGAGT CCACGTGAAA CTTGCGATAT GATACGCCTA ATCCTCGATC ACAACAACGG 
0421 GCGGGATGAA CGGGATCGGA TAGTGGTATC GTTGCAGATT TTCAATTCCT TCGAACAGGT 
0481 CGTGCATCTG ATTGCCATGT G 
 in silico PCR Fragment
0001 ACCATGGA-T AAGGTCGACT TCCAGTGCGA CAGGTGCAGC ACCCAGAATG GAATGCTTCA 
0061 GCGCAGCGGA AGATCCTCGA ATGTTAGTAC GGCCCTGCGT CTGTTGGGCG CCAATGTGGA 
0121 GTTGTTCGGT GTGCTCACCC GTAATCCCAC CTATCGCATG ATTCTGGATG ATCTCGAGCA 
0181 GCGGGGCATT GATATTAGCC ATTGTACATT CACGGACGCA AGTCCTCCCT TTTCCACAAT 
0241 TGTCCAAGAT CGCTGGACGC GTCGTTGCAC GGTGGTGTAT TGCGACAAGT CATTTCCATA 
0301 TGTTACGGCA GCGGATTTCC GCAAATTGGA TCTCGATCAA TACGGCTGGG TGAATTTTGA 
0361 GGCACGGAGT CCACGTGAAA CTTGCGATAT GATACGCCTA ATCCTCGATC ACAACAACGG 
0421 GCGGGATGAA CGGGATCGGA TAGTGGTATC GTTGCAGATT TTCAATTCCT TCGAACAGGT 
0481 CGTGCATCTG ATTGCCATGT G 
 Assemble Data

12289R-1.IR_full       1   ACCATGGAGTAAGGTCGACTTCCAGTGCGACAGGTGCAGCACCCAGAATGGAATGCTTCA 60
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
12289R-1.in silico     1   ACCATGGA-TAAGGTCGACTTCCAGTGCGACAGGTGCAGCACCCAGAATGGAATGCTTCA 60


12289R-1.IR_full       61  GCGCAGCGGAAGATCCTCGAATGTTAGTACGGCCCTGCGTCTGTTGGGCGCCAATGTGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12289R-1.in silico     61  GCGCAGCGGAAGATCCTCGAATGTTAGTACGGCCCTGCGTCTGTTGGGCGCCAATGTGGA 120


12289R-1.IR_full       121 GTTGTTCGGTGTGCTCACCCGTAATCCCACCTATCGCATGATTCTGGATGATCTCGAGCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12289R-1.in silico     121 GTTGTTCGGTGTGCTCACCCGTAATCCCACCTATCGCATGATTCTGGATGATCTCGAGCA 180


12289R-1.IR_full       181 GCGGGGCATTGATATTAGCCATTGTACATTCACGGACGCAAGTCCTCCCTTTTCCACAAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12289R-1.in silico     181 GCGGGGCATTGATATTAGCCATTGTACATTCACGGACGCAAGTCCTCCCTTTTCCACAAT 240


12289R-1.IR_full       241 TGTCCAAGATCGCTGGACGCGTCGTTGCACGGTGGTGTATTGCGACAAGTCATTTCCATA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12289R-1.in silico     241 TGTCCAAGATCGCTGGACGCGTCGTTGCACGGTGGTGTATTGCGACAAGTCATTTCCATA 300


12289R-1.IR_full       301 TGTTACGGCAGCGGATTTTCGCAAACTGGATCTCGATCAATACGGCTGGGTGAATTTTGA 360
                           |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||
12289R-1.in silico     301 TGTTACGGCAGCGGATTTCCGCAAATTGGATCTCGATCAATACGGCTGGGTGAATTTTGA 360


12289R-1.IR_full       361 GGCACGGAGTCCACGTGAAACTTGCGATATGATACGCCTAATCCTCGATCACAACAACGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12289R-1.in silico     361 GGCACGGAGTCCACGTGAAACTTGCGATATGATACGCCTAATCCTCGATCACAACAACGG 420


12289R-1.IR_full       421 GCGGGATGAACGGGATCGGATAGTGGTATCGTTGCAGATTTTCAATTCCTTCGAACAGGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12289R-1.in silico     421 GCGGGATGAACGGGATCGGATAGTGGTATCGTTGCAGATTTTCAATTCCTTCGAACAGGT 480


12289R-1.IR_full       481 CGTGCATCTGATTGCCATGTG 501
                           |||||||||||||||||||||
12289R-1.in silico     481 CGTGCATCTGATTGCCATGTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140208.1  CG12289-RA, transcript variant A (CG12289), mRNA 
90.66   437  NM_168457.1  CG12289-RB, transcript variant B (CG12289), mRNA 
0   NM_135979.1  CG15134-RA (CG15134), mRNA 
0   NM_132279.2  CG1885-RA (CG1885), mRNA 
0   NM_142598.1  CG17190-RA (CG17190), mRNA 
0   NM_133023.2  CG7846-RA (CG7846), mRNA 
0   NM_143677.2  CG11360-RA (CG11360), mRNA 
0   NM_135301.2  CG7196-RA, transcript variant A (CG7196), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_057857.4  CG8749-RA (snRNP70K), mRNA 
0   NM_137133.2  CG10143-RA (Adgf-E), mRNA 
0   NM_136017.2  CG15151-RA (PFE), mRNA 
0   NM_142415.2  CG7780-RA (DNaseII), mRNA 
0   NM_169234.1  CG9786-RB, transcript variant B (hb), mRNA 
0   NM_169233.1  CG9786-RA, transcript variant A (hb), mRNA 
0   NM_142919.1  CG10365-RA, transcript variant A (CG10365), mRNA 
0   NM_170086.1  CG10365-RB, transcript variant B (CG10365), mRNA 
0   NM_206547.1  CG10365-RD, transcript variant D (CG10365), mRNA 
0   NM_170087.1  CG10365-RC, transcript variant C (CG10365), mRNA 
0   NM_137671.1  CG15226-RA (CG15226), mRNA 
0   NM_137125.2  CG12869-RA (CG12869), mRNA 
0   NM_079357.2  CG7250-RA (Toll-6), mRNA 
0   NM_132212.2  CG1575-RA (CG1575), mRNA 
0   NM_142917.2  CG10300-RA (CG10300), mRNA 
0   NM_001014555.1  CG32333-RB, transcript variant B (CG32333), mRNA 
0   NM_167865.1  CG32333-RA, transcript variant A (CG32333), mRNA 
0   NM_001043295.1  CG34129-RA (CG34129), mRNA 
0   NM_132278.2  CG12075-RA, transcript variant A (CG12075), mRNA 
0   NM_206663.1  CG12075-RB, transcript variant B (CG12075), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.