National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12276R-3 
 Symbol Aos1  Full Name Aos1 
 CG No CG12276  Old CG No CG12276 
 Synonyms CG12276, SAE1, DmAos1, Sae1, DmSae1, Dmaos1, DmSAE1, Aos1, Aos 
 Accession No (Link to NCBI) NM_141941.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kanakousaki K, Gibson MC.
A differential requirement for SUMOylation in proliferating and non-proliferating cells during Drosophila development.
Development (2012) 139(15) 2751-62 [ PubMed ID = 22745316 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGTCGTGGATATGGACACC 
 Primer Seq. 3'
aatctagaggtaccAACCCGAAGGTGCCCCACACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGTCGTGG ATATGGACAC CAGCGAGACA GCCGTGGAGC TCACTGAGGC GGAGAACGAG 
0061 CTGTACGACA GACAAATCCG ACTCTGGGGT CTGGAATCTC AGAAACGCCT TCGCACGGCC 
0121 AAGATTCTCA TCGCTGGACT GTGCGGCCTG GGCGCCGAGA TAACCAAGAA CATCATCCTG 
0181 TCCGGAGTGA ACTCCGTGAA GCTGCTGGAT GACAAGGACG TAACCGAGGA GGACTTTTGT 
0241 TCACAATTCC TTGTCCCCCG TGAATCGCTG AACACCAACC GGGCCGAAGC ATCATTGACA 
0301 CGGGCACGTG CTCTCAATCC CATGGTGGAC ATCTCCGCCG ACCGCGAGCC CTTGAAGGAG 
0361 AAGACCTCTG AGTTCTTCGG TCAGTTCGAC GTTGTGGTGG TCAATGGCGC GACCAACGAG 
0421 GAACTGTTGC GCATTGACAC CATTTGCCGG GACCTGGGCG TCAAGTTCAT AGCCACCGAT 
0481 GTGTGGGGCA CCTTCGGGTT  
 in silico PCR Fragment
0001 ATGGTCGTGG ATATGGACAC CAGCGAGACA GCCGTGGAGC TCACTGAGGC GGAGAACGAG 
0061 CTGTACGACA GACAAATCCG ACTCTGGGGT CTGGAATCTC AGAAACGCCT TCGCACGGCC 
0121 AAGATTCTCA TCGCTGGACT GTGCGGCCTG GGCGCCGAGA TAACCAAGAA CATCATCCTG 
0181 TCCGGAGTGA ACTCCGTGAA GCTGCTGGAT GACAAGGACG TAACCGAGGA GGACTTTTGT 
0241 TCACAATTCC TTGTCCCCCG TGAATCGCTG AACACCAACC GGGCCGAAGC ATCATTGACA 
0301 CGGGCACGTG CTCTCAATCC CATGGTGGAC ATCTCCGCCG ACCGCGAGCC CTTGAAGGAG 
0361 AAGACCTCTG AGTTCTTCGG TCAGTTCGAC GTTGTGGTGG TCAATGGCGC GACCAACGAG 
0421 GAACTGTTGC GCATTGACAC CATTTGCCGG GACCTGGGCG TCAAGTTCAT AGCCACCGAT 
0481 GTGTGGGGCA CCTTCGGGTT  
 Assemble Data

12276R-3.IR_full       1   ATGGTCGTGGATATGGACACCAGCGAGACAGCCGTGGAGCTCACTGAGGCGGAGAACGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     1   ATGGTCGTGGATATGGACACCAGCGAGACAGCCGTGGAGCTCACTGAGGCGGAGAACGAG 60


12276R-3.IR_full       61  CTGTACGACAGACAAATCCGACTCTGGGGTCTGGAATCTCAGAAACGCCTTCGCACGGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     61  CTGTACGACAGACAAATCCGACTCTGGGGTCTGGAATCTCAGAAACGCCTTCGCACGGCC 120


12276R-3.IR_full       121 AAGATTCTCATCGCTGGACTGTGCGGCCTGGGCGCCGAGATAACCAAGAACATCATCCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     121 AAGATTCTCATCGCTGGACTGTGCGGCCTGGGCGCCGAGATAACCAAGAACATCATCCTG 180


12276R-3.IR_full       181 TCCGGAGTGAACTCCGTGAAGCTGCTGGATGACAAGGACGTAACCGAGGAGGACTTTTGT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     181 TCCGGAGTGAACTCCGTGAAGCTGCTGGATGACAAGGACGTAACCGAGGAGGACTTTTGT 240


12276R-3.IR_full       241 TCACAATTCCTTGTCCCCCGTGAATCGCTGAACACCAACCGGGCCGAAGCATCATTGACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     241 TCACAATTCCTTGTCCCCCGTGAATCGCTGAACACCAACCGGGCCGAAGCATCATTGACA 300


12276R-3.IR_full       301 CGGGCACGTGCTCTCAATCCCATGGTGGACATCTCCGCCGACCGCGAGCCCTTGAAGGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     301 CGGGCACGTGCTCTCAATCCCATGGTGGACATCTCCGCCGACCGCGAGCCCTTGAAGGAG 360


12276R-3.IR_full       361 AAGACCTCTGAGTTCTTCGGTCAGTTCGACGTTGTGGTGGTCAATGGCGCGACCAACGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     361 AAGACCTCTGAGTTCTTCGGTCAGTTCGACGTTGTGGTGGTCAATGGCGCGACCAACGAG 420


12276R-3.IR_full       421 GAACTGTTGCGCATTGACACCATTTGCCGGGACCTGGGCGTCAAGTTCATAGCCACCGAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12276R-3.in silico     421 GAACTGTTGCGCATTGACACCATTTGCCGGGACCTGGGCGTCAAGTTCATAGCCACCGAT 480


12276R-3.IR_full       481 GTGTGGGGCACCTTCGGGTT 500
                           ||||||||||||||||||||
12276R-3.in silico     481 GTGTGGGGCACCTTCGGGTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141941.2  CG12276-RA (Aos1), mRNA 
0   NM_136046.2  CG15161-RA (CG15161), mRNA 
0   NM_135866.2  CG7532-RA (CG7532), mRNA 
0   NM_164365.1  CG4822-RC, transcript variant C (CG4822), mRNA 
0   NM_134649.4  CG4822-RD, transcript variant D (CG4822), mRNA 
0   NM_001038774.1  CG4822-RG, transcript variant G (CG4822), mRNA 
0   NM_001038775.1  CG4822-RH, transcript variant H (CG4822), mRNA 
0   NM_001038773.1  CG4822-RF, transcript variant F (CG4822), mRNA 
0   NM_164364.2  CG4822-RB, transcript variant B (CG4822), mRNA 
0   NM_135684.1  CG16965-RA (CG16965), mRNA 
0   NM_141798.1  CG10703-RA (CG10703), mRNA 
0   NM_167558.1  CG32562-RA (xmas-2), mRNA 
0   NM_136910.1  CG13165-RA (CG13165), mRNA 
0   NM_137296.2  CG8306-RA (CG8306), mRNA 
0   NM_165347.1  CG31675-RA (CG31675), mRNA 
0   NM_140628.1  CG4842-RA (CG4842), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 
0   NM_078662.2  CG5488-RA (B-H2), mRNA 
0   NM_141182.2  CG18143-RA (CG18143), mRNA 
0   NM_135793.2  CG16970-RA (CG16970), mRNA 
0   NM_135545.2  CG5366-RA (CG5366), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_078836.2  CG12403-RA (Vha68-1), mRNA 
0   NM_143054.2  CG11168-RA (CG11168), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.