National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12268R-4 
 Symbol CG12268  Full Name CG12268 
 CG No CG12268  Old CG No CG12268 
 Synonyms CG12268 
 Accession No (Link to NCBI) NM_142940.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATACTGAGGAGCGATGCCGA 
 Primer Seq. 3'
aatctagaggtaccACTGGCAGTATGAGGTGGACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATACTGAGG AGCGATGCCG ATTGCgGNGA GTCCGATATT GCCAAGTTCT ATGCAAACAA 
0061 AACCATCCTT ATTACGGGTG CCACCGGATT TATGGGCAAG GTTCTGGTGG AGAAACTACT 
0121 GCGTAGCTGT GCCGACCTGA ACGTCATATA TCTATTGATA CGCACCAAAA AGGGGGTCGA 
0181 TCCCAGTGTG CGCAAGGAGC AGTACTTCAA GTGTGTGATC TTTGGCAAGC TGCTGGAGAA 
0241 GAATCCCGGC ATCGTGGACA AGGTGCGCGT GGTAAAGGGC GATCTGCTGG AGCCGGACCT 
0301 TGGCCTGAGC GCCAATGACA CCAACACACT CGCCTCCAAC GTCGAGGTGG TCTTCCACTG 
0361 TGCGGCCAAT GTGCGCTTCG ACCAGCCGCT GCGTCCCATG GTCATGATGA ACGTGGTGGG 
0421 CACCCTGAAG GTCCTCCGAC TCGCTGAGAA GATGAGCCAG CTGCAGGCTC TGGTCCACGT 
0481 GTCCACCTCA TACTGCCAGT  
 in silico PCR Fragment
0001 CATACTGAGG AGCGATGCCG ATTGCGGCGA GTCCGATATT GCCAAGTTCT ATGCAAACAA 
0061 AACCATCCTT ATTACGGGTG CCACCGGATT TATGGGCAAG GTTCTGGTGG AGAAACTACT 
0121 GCGTAGCTGT GCCGACCTGA ACGTCATATA TCTATTGATA CGCACCAAAA AAGGGGTCGA 
0181 TCCCAGTGTG CGCAAGGAGC AGTACTTCAA GTGTGTGATC TTTGGCAAGC TGCTGGAGAA 
0241 GAATCCCGGC ATCGTGGACA AGGTGCGCGT GGTAAAGGGC GATCTGCTGG AGCCGGACCT 
0301 TGGCCTGAGC GCCAATGACA CCAACACACT CGCCTCCAAC GTCGAGGTGG TCTTCCACTG 
0361 TGCGGCCAAT GTGCGCTTCG ACCAGCCGCT GCGTCCCATG GTCATGATGA ACGTGGTGGG 
0421 CACCCTGAAG GTCCTCCGCC TCGCTGAGAA GATGAGCCAG CTGCAGGCTC TGGTCCACGT 
0481 GTCCACCTCA TACTGCCAGT  
 Assemble Data

12268R-4.IR_full       1   CATACTGAGGAGCGATGCCGATTGCGGNGAGTCCGATATTGCCAAGTTCTATGCAAACAA 60
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
12268R-4.in silico     1   CATACTGAGGAGCGATGCCGATTGCGGCGAGTCCGATATTGCCAAGTTCTATGCAAACAA 60


12268R-4.IR_full       61  AACCATCCTTATTACGGGTGCCACCGGATTTATGGGCAAGGTTCTGGTGGAGAAACTACT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12268R-4.in silico     61  AACCATCCTTATTACGGGTGCCACCGGATTTATGGGCAAGGTTCTGGTGGAGAAACTACT 120


12268R-4.IR_full       121 GCGTAGCTGTGCCGACCTGAACGTCATATATCTATTGATACGCACCAAAAAGGGGGTCGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
12268R-4.in silico     121 GCGTAGCTGTGCCGACCTGAACGTCATATATCTATTGATACGCACCAAAAAAGGGGTCGA 180


12268R-4.IR_full       181 TCCCAGTGTGCGCAAGGAGCAGTACTTCAAGTGTGTGATCTTTGGCAAGCTGCTGGAGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12268R-4.in silico     181 TCCCAGTGTGCGCAAGGAGCAGTACTTCAAGTGTGTGATCTTTGGCAAGCTGCTGGAGAA 240


12268R-4.IR_full       241 GAATCCCGGCATCGTGGACAAGGTGCGCGTGGTAAAGGGCGATCTGCTGGAGCCGGACCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12268R-4.in silico     241 GAATCCCGGCATCGTGGACAAGGTGCGCGTGGTAAAGGGCGATCTGCTGGAGCCGGACCT 300


12268R-4.IR_full       301 TGGCCTGAGCGCCAATGACACCAACACACTCGCCTCCAACGTCGAGGTGGTCTTCCACTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12268R-4.in silico     301 TGGCCTGAGCGCCAATGACACCAACACACTCGCCTCCAACGTCGAGGTGGTCTTCCACTG 360


12268R-4.IR_full       361 TGCGGCCAATGTGCGCTTCGACCAGCCGCTGCGTCCCATGGTCATGATGAACGTGGTGGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12268R-4.in silico     361 TGCGGCCAATGTGCGCTTCGACCAGCCGCTGCGTCCCATGGTCATGATGAACGTGGTGGG 420


12268R-4.IR_full       421 CACCCTGAAGGTCCTCCGACTCGCTGAGAAGATGAGCCAGCTGCAGGCTCTGGTCCACGT 480
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
12268R-4.in silico     421 CACCCTGAAGGTCCTCCGCCTCGCTGAGAAGATGAGCCAGCTGCAGGCTCTGGTCCACGT 480


12268R-4.IR_full       481 GTCCACCTCATACTGCCAGT 500
                           ||||||||||||||||||||
12268R-4.in silico     481 GTCCACCTCATACTGCCAGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142940.2  CG12268-RA, transcript variant A (CG12268), mRNA 
100   482  NM_176550.1  CG12268-RB, transcript variant B (CG12268), mRNA 
0   NM_166697.1  CG30427-RC, transcript variant C (CG30427), mRNA 
0   NM_166699.1  CG30427-RD, transcript variant D (CG30427), mRNA 
0   NM_166698.1  CG30427-RA, transcript variant A (CG30427), mRNA 
0   NM_138136.2  CG30427-RB, transcript variant B (CG30427), mRNA 
0   11  NM_169464.2  CG10097-RA, transcript variant A (CG10097), mRNA 
0   11  NM_141929.2  CG10096-RA, transcript variant A (CG10096), mRNA 
0   10  NM_001032012.1  CG10096-RB, transcript variant B (CG10096), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   14  NM_132048.1  CG4020-RA (CG4020), mRNA 
0   NM_142310.1  CG17560-RA (CG17560), mRNA 
0   NM_165831.1  CG7759-RA, transcript variant A (CG7759), mRNA 
0   NM_136840.2  CG7759-RB, transcript variant B (CG7759), mRNA 
0   NM_132852.1  CG8565-RA (CG8565), mRNA 
0   NM_141634.1  CG9361-RA (Task7), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0   NM_139978.3  CG6781-RA (CG6781), mRNA 
0   NM_132121.2  CG3135-RA (shf), mRNA 
0   NM_080011.2  CG7035-RB, transcript variant B (Cbp80), mRNA 
0   NM_167012.1  CG7035-RA, transcript variant A (Cbp80), mRNA 
0   21  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   12  NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   12  NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   NM_142988.2  CG5728-RA (CG5728), mRNA 
0   NM_139437.1  CG15879-RA (CG15879), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.