National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1225R-2 
 Symbol RhoGEF3  Full Name RhoGEF3 
 CG No CG1225  Old CG No CG1225 
 Synonyms CG1225, DrhoGEF3, RhoGEF3 
 Accession No (Link to NCBI) NM_138183.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||| ||||||||||||   | |||||||||||||||||||||||||||||| silico     1   CAAGTGGCGAA-AGTGCAAAGCGC---A-GCAAAGTGCGAAAAGAAGGCAACAAGTCGA- 60

                           |||||||||||||||   |||||| |||||||||||||||||||||||||||||||||| silico      61  ATATGAACACAAACA---GTCCCA-GCAAAAATGTGACTGTGAAATCGTCACAGCTATA 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TAGGTATATAGCGCCCAGGAACCGATCCATGCTTGTCATGAAGGATCCACGGAGCATGCG 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AACCTTACGACGAATGCCAAAACCTGGAAGCAATGAAATGGGAACAACCAGTGACTGCGC 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCGAGTTTGTCACAGCAAATAAAGGCGGTCTCCAGTCCAACGCTGTCCGAGCCGTGCTT 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGAGGAGCAGCCACAAAAAGGAACTGAAAGTACGGATGTGGCCAACACAGGCAGCAGCGC 359

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGG-AAGTGGAGGCCTAGGCGTATTGCAGAAATTCAAACGCACCTTGAACAACTTTAACA 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAAAAATCAATTGCACATCTCTCCGCTATCACCAGCGGCAGTAGGTAACAATGCCCCAA 479

                          ||||||||||||||||||||||||||| |||| silico     481 AAACTAAGACATCGCCAACAACAACAACCGCA 511

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138183.2  CG1225-RA, transcript variant A (RhoGEF3), mRNA 
50.62   244  NM_167825.1  CG1225-RC, transcript variant C (RhoGEF3), mRNA 
40.66   196  NM_167823.1  CG1225-RB, transcript variant B (RhoGEF3), mRNA 
39.41   190  NM_167824.1  CG1225-RE, transcript variant E (RhoGEF3), mRNA 
0.41   NM_169823.1  CG7693-RB, transcript variant B (fray), mRNA 
0.41   NM_057960.3  CG7693-RA, transcript variant A (fray), mRNA 
0   NM_164788.1  CG31605-RH, transcript variant H (Bsg), mRNA 
0   NM_164787.1  CG31605-RF, transcript variant F (Bsg), mRNA 
0   NM_164785.1  CG31605-RD, transcript variant D (Bsg), mRNA 
0   NM_164784.1  CG31605-RC, transcript variant C (Bsg), mRNA 
0   NM_164786.1  CG31605-RE, transcript variant E (Bsg), mRNA 
0   NM_164789.1  CG31605-RI, transcript variant I (Bsg), mRNA 
0   NM_164783.1  CG31605-RB, transcript variant B (Bsg), mRNA 
0   NM_164782.1  CG31605-RA, transcript variant A (Bsg), mRNA 
0   NM_136081.2  CG10641-RA (CG10641), mRNA 
0   NM_132627.1  CG4346-RA (rad), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_079107.2  CG11173-RA (usnp), mRNA 
0   NM_167657.1  CG12233-RB, transcript variant B (l(1)G0156), mRNA 
0   NM_133160.1  CG12233-RA, transcript variant A (l(1)G0156), mRNA 
0   11  NM_134301.3  CG1759-RB, transcript variant B (cad), mRNA 
0   11  NM_057606.4  CG1759-RA, transcript variant A (cad), mRNA 
0   NM_143606.1  CG15566-RA (CG15566), mRNA 
0   18  NM_080020.3  CG11491-RE, transcript variant E (br), mRNA 
0   NM_001038712.1  CG33978-RA (CG33978), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_137534.1  CG15082-RA (CG15082), mRNA 
0   NM_165832.1  CG30026-RA (CG30026), mRNA 
0   NM_135644.2  CG4713-RA (CG4713), mRNA 
0   31  NM_078592.2  CG11172-RA (NFAT), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.