National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1225R-1 
 Symbol RhoGEF3  Full Name RhoGEF3 
 CG No CG1225  Old CG No CG1225 
 Synonyms CG1225, DrhoGEF3, RhoGEF3 
 Accession No (Link to NCBI) NM_138183.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGTGGCGAAAGTGCAAAGC 
 Primer Seq. 3'
aatctagaggtaccTGCGGTTGTTGTTGTTGGCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAGTGGCGA ACAGTGCAAA gCGCNTGATG CAAAGTGCGA AAAGAAGGCA ACAAGTCGAN 
0061 NATATGAACA CAAACANGTG TCCCANGCAA AAATGTGACT GTGAAATCGT CACAGCTATA 
0121 TAGGTATATA GCGCCCAGGA ACCGATCCAT GCTTGTCATG AAGGATCCAC GGAGCATGCG 
0181 AACCTTACGA CGAATGCCAA AACCTGGAAG CAATGAAATG GGAACAACCA GTGACTGCGC 
0241 TGCGAGTTTG TCACAGCAAA TAAAGGCGGT CTCCAGTCCA ACGCTGTCCG AGCCGTGCTT 
0301 AGAGGAGCAG CCACAAAAAG GAACTGAAAG TACGGATGTG GCCAACACAG GCAGCAGCGC 
0361 CGGNAAGTGG AGGCCTAGGC GTATTGCAGA AATTCAAACG CACCTTGAAC AACTTTAACA 
0421 ACAAAAATCA ATTGCACATC TCTCCGCTAT CACCAGCGGC AGTAGGTAAC AATGCCCCAA 
0481 AAACTAAGAC ATCGCCAACA ACAACAANCG CA 
 in silico PCR Fragment
0001 CAAGTGGCGA A-AGTGCAAA GCGC---A-G CAAAGTGCGA AAAGAAGGCA ACAAGTCGA- 
0061 -ATATGAACA CAAACA---G TCCCA-GCAA AAATGTGACT GTGAAATCGT CACAGCTATA 
0121 TAGGTATATA GCGCCCAGGA ACCGATCCAT GCTTGTCATG AAGGATCCAC GGAGCATGCG 
0181 AACCTTACGA CGAATGCCAA AACCTGGAAG CAATGAAATG GGAACAACCA GTGACTGCGC 
0241 TGCGAGTTTG TCACAGCAAA TAAAGGCGGT CTCCAGTCCA ACGCTGTCCG AGCCGTGCTT 
0301 AGAGGAGCAG CCACAAAAAG GAACTGAAAG TACGGATGTG GCCAACACAG GCAGCAGCGC 
0361 CGG-AAGTGG AGGCCTAGGC GTATTGCAGA AATTCAAACG CACCTTGAAC AACTTTAACA 
0421 ACAAAAATCA ATTGCACATC TCTCCGCTAT CACCAGCGGC AGTAGGTAAC AATGCCCCAA 
0481 AAACTAAGAC ATCGCCAACA ACAACAACCG CA 
 Assemble Data

1225R-1.IR_full       1   CAAGTGGCGAACAGTGCAAAGCGCNTGATGCAAAGTGCGAAAAGAAGGCAACAAGTCGAN 60
                          ||||||||||| ||||||||||||   | |||||||||||||||||||||||||||||| 
1225R-1.in silico     1   CAAGTGGCGAA-AGTGCAAAGCGC---A-GCAAAGTGCGAAAAGAAGGCAACAAGTCGA- 60


1225R-1.IR_full        61  ATATGAACACAAACANGTGTCCCANGCAAAAATGTGACTGTGAAATCGTCACAGCTATA 119
                           |||||||||||||||   |||||| ||||||||||||||||||||||||||||||||||
1225R-1.in silico      61  ATATGAACACAAACA---GTCCCA-GCAAAAATGTGACTGTGAAATCGTCACAGCTATA 119


1225R-1.IR_full       121 TAGGTATATAGCGCCCAGGAACCGATCCATGCTTGTCATGAAGGATCCACGGAGCATGCG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1225R-1.in silico     121 TAGGTATATAGCGCCCAGGAACCGATCCATGCTTGTCATGAAGGATCCACGGAGCATGCG 179


1225R-1.IR_full       181 AACCTTACGACGAATGCCAAAACCTGGAAGCAATGAAATGGGAACAACCAGTGACTGCGC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1225R-1.in silico     181 AACCTTACGACGAATGCCAAAACCTGGAAGCAATGAAATGGGAACAACCAGTGACTGCGC 239


1225R-1.IR_full       241 TGCGAGTTTGTCACAGCAAATAAAGGCGGTCTCCAGTCCAACGCTGTCCGAGCCGTGCTT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1225R-1.in silico     241 TGCGAGTTTGTCACAGCAAATAAAGGCGGTCTCCAGTCCAACGCTGTCCGAGCCGTGCTT 299


1225R-1.IR_full       301 AGAGGAGCAGCCACAAAAAGGAACTGAAAGTACGGATGTGGCCAACACAGGCAGCAGCGC 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1225R-1.in silico     301 AGAGGAGCAGCCACAAAAAGGAACTGAAAGTACGGATGTGGCCAACACAGGCAGCAGCGC 359


1225R-1.IR_full       361 CGGNAAGTGGAGGCCTAGGCGTATTGCAGAAATTCAAACGCACCTTGAACAACTTTAACA 419
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1225R-1.in silico     361 CGG-AAGTGGAGGCCTAGGCGTATTGCAGAAATTCAAACGCACCTTGAACAACTTTAACA 419


1225R-1.IR_full       421 ACAAAAATCAATTGCACATCTCTCCGCTATCACCAGCGGCAGTAGGTAACAATGCCCCAA 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1225R-1.in silico     421 ACAAAAATCAATTGCACATCTCTCCGCTATCACCAGCGGCAGTAGGTAACAATGCCCCAA 479


1225R-1.IR_full       481 AAACTAAGACATCGCCAACAACAACAANCGCA 511
                          ||||||||||||||||||||||||||| ||||
1225R-1.in silico     481 AAACTAAGACATCGCCAACAACAACAACCGCA 511

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138183.2  CG1225-RA, transcript variant A (RhoGEF3), mRNA 
50.62   244  NM_167825.1  CG1225-RC, transcript variant C (RhoGEF3), mRNA 
40.66   196  NM_167823.1  CG1225-RB, transcript variant B (RhoGEF3), mRNA 
39.41   190  NM_167824.1  CG1225-RE, transcript variant E (RhoGEF3), mRNA 
0.41   NM_169823.1  CG7693-RB, transcript variant B (fray), mRNA 
0.41   NM_057960.3  CG7693-RA, transcript variant A (fray), mRNA 
0   NM_164788.1  CG31605-RH, transcript variant H (Bsg), mRNA 
0   NM_164787.1  CG31605-RF, transcript variant F (Bsg), mRNA 
0   NM_164785.1  CG31605-RD, transcript variant D (Bsg), mRNA 
0   NM_164784.1  CG31605-RC, transcript variant C (Bsg), mRNA 
0   NM_164786.1  CG31605-RE, transcript variant E (Bsg), mRNA 
0   NM_164789.1  CG31605-RI, transcript variant I (Bsg), mRNA 
0   NM_164783.1  CG31605-RB, transcript variant B (Bsg), mRNA 
0   NM_164782.1  CG31605-RA, transcript variant A (Bsg), mRNA 
0   NM_136081.2  CG10641-RA (CG10641), mRNA 
0   NM_132627.1  CG4346-RA (rad), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_079107.2  CG11173-RA (usnp), mRNA 
0   NM_167657.1  CG12233-RB, transcript variant B (l(1)G0156), mRNA 
0   NM_133160.1  CG12233-RA, transcript variant A (l(1)G0156), mRNA 
0   11  NM_134301.3  CG1759-RB, transcript variant B (cad), mRNA 
0   11  NM_057606.4  CG1759-RA, transcript variant A (cad), mRNA 
0   NM_143606.1  CG15566-RA (CG15566), mRNA 
0   18  NM_080020.3  CG11491-RE, transcript variant E (br), mRNA 
0   NM_001038712.1  CG33978-RA (CG33978), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_137534.1  CG15082-RA (CG15082), mRNA 
0   NM_165832.1  CG30026-RA (CG30026), mRNA 
0   NM_135644.2  CG4713-RA (CG4713), mRNA 
0   31  NM_078592.2  CG11172-RA (NFAT), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.