National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12238R-2 
 Symbol l(1)G0084  Full Name enhancer of yellow 3 
 CG No CG12238  Old CG No CG12238 
 Synonyms CG12238, SAYP, l(1)G0084 
 Accession No (Link to NCBI) NM_134490.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCAGCAGATGGTAGCAGCGA 
 Primer Seq. 3'
aatctagaggtaccCTCTACCTCAAGCGCCGTAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCAGCAGAT GGTAGCAGCG ACATCGTCAT CAGGATCGGA ATCGGGAACA GCGGTAGAAT 
0061 CGGCAGCCGC CACGTCCACA GCAGGATCAG CCGGAGCAGC AGGTCGCCCC CAGTCTAACT 
0121 GTAGCGCTAA TAGCAACGCC AAGTCAGTGG CAGCGAGCAG CACGAGCGAG GAGGAGCAGC 
0181 GAGTTAGCTC CACGTCGTCG CCAGCCCAGC GGGATCAGCA GCTGAATGCA GATCGGGACC 
0241 GGGAACAGGA GCCAGAGCCA CAGCAGCAGC AGCAGCGGGA GGAGGCACTG CAGCACCAGC 
0301 ATAATCAGCC CGGCCATATA ACCNAGCACC ACAGCGTCGC CTCCGCCGAC GCTGCCACCG 
0361 CCGACGACGC CGTGCGACGA TGCCCCAAGC ACAACTGGAG CATCTGCATC GGCCAGCTCA 
0421 GCATCCGGAG AAGCACCATC AGCAGCATCA GCAGCGGGAG CAGCNAGGTG GACCGATGGC 
0481 CGCTACGGCG CTTGAGGTAG AG 
 in silico PCR Fragment
0001 AGCAGCAGAT GGTAGCAGCG ACATCGTCAT CAGGATCGGA ATCGGGAACA GCGGTAGAAT 
0061 CGGCAGCCGC CACGTCCACA GCAGGATCAG CCGGAGCAGC AGGTCGCCCC CAGTCTAACT 
0121 GTAGCGCTAA TAGCAACGCC AAGTCAGTGG CAGCGAGCAG CACGAGCGAG GAGGAGCAGC 
0181 GAGTTAGCTC CACGTCGTCG CCAGCCCAGC GGGATCAGCA GCTGAATGCA GATCGGGACC 
0241 GGGAACAGGA GCCAGAGCCA CAGCAGCAGC AGCAGCGGGA GGAGGCACTG CAGCACCAGC 
0301 ATAATCAGCC CGGCCATATA ACC-AGCACC ACAGCGTCGC CTCCGCCGAC GCTGCCACCG 
0361 CCGACGACGC CGTGCGACGA TGCCCCAAGC ACAACTGGAG CATCTGCATC GGCCAGCTCA 
0421 GCATCCGGAG AAGCACCATC AGCAGCATCA GCAGCGGGAG CAGC-AGGTG GACCGATGGC 
0481 CGCTACGGCG CTTGAGGTAG AG 
 Assemble Data

12238R-2.IR_full       1   AGCAGCAGATGGTAGCAGCGACATCGTCATCAGGATCGGAATCGGGAACAGCGGTAGAAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12238R-2.in silico     1   AGCAGCAGATGGTAGCAGCGACATCGTCATCAGGATCGGAATCGGGAACAGCGGTAGAAT 60


12238R-2.IR_full       61  CGGCAGCCGCCACGTCCACAGCAGGATCAGCCGGAGCAGCAGGTCGCCCCCAGTCTAACT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12238R-2.in silico     61  CGGCAGCCGCCACGTCCACAGCAGGATCAGCCGGAGCAGCAGGTCGCCCCCAGTCTAACT 120


12238R-2.IR_full       121 GTAGCGCTAATAGCAACGCCAAGTCAGTGGCAGCGAGCAGCACGAGCGAGGAGGAGCAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12238R-2.in silico     121 GTAGCGCTAATAGCAACGCCAAGTCAGTGGCAGCGAGCAGCACGAGCGAGGAGGAGCAGC 180


12238R-2.IR_full       181 GAGTTAGCTCCACGTCGTCGCCAGCCCAGCGGGATCAGCAGCTGAATGCAGATCGGGACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12238R-2.in silico     181 GAGTTAGCTCCACGTCGTCGCCAGCCCAGCGGGATCAGCAGCTGAATGCAGATCGGGACC 240


12238R-2.IR_full       241 GGGAACAGGAGCCAGAGCCACAGCAGCAGCAGCAGCGGGAGGAGGCACTGCAGCACCAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12238R-2.in silico     241 GGGAACAGGAGCCAGAGCCACAGCAGCAGCAGCAGCGGGAGGAGGCACTGCAGCACCAGC 300


12238R-2.IR_full       301 ATAATCAGCCCGGCCATATAACCNAGCACCACAGCGTCGCCTCCGCCGACGCTGCCACCG 360
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
12238R-2.in silico     301 ATAATCAGCCCGGCCATATAACC-AGCACCACAGCGTCGCCTCCGCCGACGCTGCCACCG 360


12238R-2.IR_full       361 CCGACGACGCCGTGCGACGATGCCCCAAGCACAACTGGAGCATCTGCATCGGCCAGCTCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12238R-2.in silico     361 CCGACGACGCCGTGCGACGATGCCCCAAGCACAACTGGAGCATCTGCATCGGCCAGCTCA 420


12238R-2.IR_full       421 GCATCCGGAGAAGCACCATCAGCAGCATCAGCAGCGGGAGCAGCNAGGTGGACCGATGGC 480
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
12238R-2.in silico     421 GCATCCGGAGAAGCACCATCAGCAGCATCAGCAGCGGGAGCAGC-AGGTGGACCGATGGC 480


12238R-2.IR_full       481 CGCTACGGCGCTTGAGGTAGAG 502
                           ||||||||||||||||||||||
12238R-2.in silico     481 CGCTACGGCGCTTGAGGTAGAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  23  123  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
1.03   38  158  NM_001015268.1  CG40450-PB.3 (CG40450), mRNA 
1.03   38  145  NM_001015269.1  CG40450-PA.3 (CG40450), mRNA 
0.82   53  283  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0.82   53  283  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0.82   41  201  NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
0.82   41  200  NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
0.82   41  200  NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
0.82   41  200  NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
0.82   10  19  NM_165907.3  CG12370-RA (CG12370), mRNA 
0.62   13  31  121  NM_079322.2  CG10605-RA (caup), mRNA 
0.62   12  67  315  NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0.62   12  67  315  NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0.62   12  67  315  NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0.62   51  207  NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0.62   33  186  NM_136533.1  CG11641-RA (pdm3), mRNA 
0.41   29  131  553  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0.41   29  131  553  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0.41   22  110  NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0.41   11  64  NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0.41   11  64  NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0.41   12  60  NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 
0.41   18  NM_140928.2  CG32223-RA (CG32223), mRNA 
0.41   13  NM_176122.1  CG33183-RB, transcript variant B (Hr46), mRNA 
0.41   39  168  NM_001042891.1  CG31761-RE, transcript variant E (bru-2), mRNA 
0.41   52  NM_165255.1  CG10283-RB, transcript variant B (CG10283), mRNA 
0.41   52  NM_136035.4  CG10283-RA, transcript variant A (CG10283), mRNA 
0.41   10  NM_140918.1  CG14185-RA (CG14185), mRNA 
0.2   13  55  270  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
0.2   40  196  NM_135793.2  CG16970-RA (CG16970), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.