National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12235R-3 
 Symbol Arp11  Full Name Arp11 
 CG No CG12235  Old CG No CG12235 
 Synonyms CG12235, ARP11, Arp11 
 Accession No (Link to NCBI) NM_134494.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGACATTGGCACCGCCTACA 
 Primer Seq. 3'
aatctagaggtaccCTTAACGCCACTCTCAACCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGACATTGG CACCGCCTAC ACCAAGCTGG GATTCGCAGC CGGAGGcGTA TCCGCGCAAG 
0061 ATCATGCCCA CGGAGGTGGT GATGACCACG ACGGGGATCC GGAAGCGTCT GTTCGACTAC 
0121 GACACTCCGG AGGAGCTGTA CGACCAGCTA GTGGATTTTC TGCAGACGAT CTTCTTCAAG 
0181 CATCTACTGG TCAGCCCCAA GGAGCGCAAG TTCGTGCTGG TGGAGAACGT GTTCGGATCC 
0241 ACTGTGCTGC GTGAAACCTT GGCCCGCGTG CTCTTTGTCC ACTTCGACGT CTCCTCCGTG 
0301 CTGTTCGTGC CCGTGCATCT CATTGCGCTG TCTACGCTGG CAGTGCCCAC TGCCCTTGTG 
0361 GTGGACGTTG GCTACAGCGA GACCAGCGTT ATGCCCGTCT TCAGCGGGGT GCAAATCATG 
0421 GCCGCCTTCA AGGATCAGAG CTACGGAGGC AGCGCCATCC ACGCGGAGAT CAAGCGGCAG 
0481 CTGGTTGAGA GTGGCGTTAA G 
 in silico PCR Fragment
0001 TCGACATTGG CACCGCCTAC ACCAAGCTGG GATTCGCAG- CGGAGGCGTA TCCGCGCAAG 
0061 ATCATGCCCA CGGAGGTGGT GATGACCACG ACGGGGATCC GGAAGCGTCT GTTCGACTAC 
0121 GACACTCCGG AGGAGCTGTA CGACCAGCTA GTGGATTTTC TGCAGACGAT CTTCTTCAAG 
0181 CATCTACTGG TCAGCCCCAA GGAGCGCAAG TTCGTGCTGG TGGAGAACGT GTTCGGATCC 
0241 ACTGTGCTGC GTGAAACCTT GGCCCGCGTG CTCTTTGTCC ACTTCGACGT CTCCTCCGTG 
0301 CTGTTCGTGC CCGTGCATCT CATTGCGCTG TCTACGCTGG CAGTGCCCAC TGCCCTTGTG 
0361 GTGGACGTTG GCTACAGCGA GACCAGCGTT ATGCCCGTCT TCAGCGGGGT GCAAATCATG 
0421 GCCGCCTTCA AGGATCAGAG CTACGGAGGC AGCGCCATCC ACGCGGAGAT CAAGCGGCAG 
0481 CTGGTTGAGA GTGGCGTTAA G 
 Assemble Data

12235R-3.IR_full       1   TCGACATTGGCACCGCCTACACCAAGCTGGGATTCGCAGCCGGAGGCGTATCCGCGCAAG 60
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
12235R-3.in silico     1   TCGACATTGGCACCGCCTACACCAAGCTGGGATTCGCAG-CGGAGGCGTATCCGCGCAAG 60


12235R-3.IR_full       61  ATCATGCCCACGGAGGTGGTGATGACCACGACGGGGATCCGGAAGCGTCTGTTCGACTAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12235R-3.in silico     61  ATCATGCCCACGGAGGTGGTGATGACCACGACGGGGATCCGGAAGCGTCTGTTCGACTAC 120


12235R-3.IR_full       121 GACACTCCGGAGGAGCTGTACGACCAGCTAGTGGATTTTCTGCAGACGATCTTCTTCAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12235R-3.in silico     121 GACACTCCGGAGGAGCTGTACGACCAGCTAGTGGATTTTCTGCAGACGATCTTCTTCAAG 180


12235R-3.IR_full       181 CATCTACTGGTCAGCCCCAAGGAGCGCAAGTTCGTGCTGGTGGAGAACGTGTTCGGATCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12235R-3.in silico     181 CATCTACTGGTCAGCCCCAAGGAGCGCAAGTTCGTGCTGGTGGAGAACGTGTTCGGATCC 240


12235R-3.IR_full       241 ACTGTGCTGCGTGAAACCTTGGCCCGCGTGCTCTTTGTCCACTTCGACGTCTCCTCCGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12235R-3.in silico     241 ACTGTGCTGCGTGAAACCTTGGCCCGCGTGCTCTTTGTCCACTTCGACGTCTCCTCCGTG 300


12235R-3.IR_full       301 CTGTTCGTGCCCGTGCATCTCATTGCGCTGTCTACGCTGGCAGTGCCCACTGCCCTTGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12235R-3.in silico     301 CTGTTCGTGCCCGTGCATCTCATTGCGCTGTCTACGCTGGCAGTGCCCACTGCCCTTGTG 360


12235R-3.IR_full       361 GTGGACGTTGGCTACAGCGAGACCAGCGTTATGCCCGTCTTCAGCGGGGTGCAAATCATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12235R-3.in silico     361 GTGGACGTTGGCTACAGCGAGACCAGCGTTATGCCCGTCTTCAGCGGGGTGCAAATCATG 420


12235R-3.IR_full       421 GCCGCCTTCAAGGATCAGAGCTACGGAGGCAGCGCCATCCACGCGGAGATCAAGCGGCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12235R-3.in silico     421 GCCGCCTTCAAGGATCAGAGCTACGGAGGCAGCGCCATCCACGCGGAGATCAAGCGGCAG 480


12235R-3.IR_full       481 CTGGTTGAGAGTGGCGTTAAG 501
                           |||||||||||||||||||||
12235R-3.in silico     481 CTGGTTGAGAGTGGCGTTAAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134494.2  CG12235-RA (Arp11), mRNA 
0   NM_136355.1  CG14593-RA (CG14593), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 
0   NM_206140.1  CG8912-RC, transcript variant C (Psi), mRNA 
0   NM_137617.3  CG11209-RA (ppk6), mRNA 
0   NM_140397.1  CG10089-RD, transcript variant D (CG10089), mRNA 
0   NM_168548.1  CG10089-RA, transcript variant A (CG10089), mRNA 
0   NM_168549.1  CG10089-RB, transcript variant B (CG10089), mRNA 
0   NM_168550.1  CG10089-RC, transcript variant C (CG10089), mRNA 
0   NM_136054.2  CG10341-RA (CG10341), mRNA 
0   NM_206712.1  CG33248-RA (CG33248), mRNA 
0   NM_136599.2  CG8193-RA (CG8193), mRNA 
0   NM_134846.2  CG3227-RA (insv), mRNA 
0   NM_130496.2  CG16982-RA (Roc1a), mRNA 
0   NM_136935.1  CG8834-RA (CG8834), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   11  NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   11  NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   11  NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   11  NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   11  NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   11  NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   11  NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   11  NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
0   11  NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   11  NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   11  NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   11  NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.