National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12217R-2 
 Symbol PpV  Full Name Protein phosphatase V 
 CG No CG12217  Old CG No CG12217 
 Synonyms DmPpV-6A, CG12217, PPV, PPPV6A, PPV 6A, PpV 
 Accession No (Link to NCBI) NM_078506.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Chi C, Wang L, Lan W, Zhao L, Su Y.
PpV, acting via the JNK pathway, represses apoptosis during normal development of Drosophila wing.
Apoptosis (2018) 23(9-10) 554-562 [ PubMed ID = 30159848 ] [ RRC reference ]

Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat. Cell Biol. (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAATGCAAGTACCTGCCGGAG 
 Primer Seq. 3'
aatctagaggtaccCGATCGATCGTCCTGATCTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAATGCAAGT ACCTGCCGGA GAACGAGCTG AAGAAGCTAT GCGAGATGGT CTGCGATATC 
0061 CTCCTGGAGG AGAACGAACA TCCTGCCCGT GAGCACGCCC GTCACCGTTT GCGGTGACAT 
0121 CNCATGGCCA GTTCTACGAC CTGGAGCAGC TGTTCCGCAC TGGAGGCCAG GTGCCGCNAT 
0181 ACCAACTACA TATTCATGGG CGACTTCGTG GACAGGGGCT ACTACTCGCT GGAGACATTC 
0241 ACCAGACTGC TCACGCTGAA GGCGCGCTTA TCCCAGCCGG ATCACCCTGC TGCGCGGCAA 
0301 CCACGAGACG CGGCAGATCA CCAAGGTGTA CGGATTCTTT GACGAGTGCT TCAGCAAGTA 
0361 CGGCAATGcC AATGGCTGGA AATACTGCTG CAAGGTCTTC GATTTGCTTA CCATCGCTGC 
0421 CATCATCGAC GAGGAGGTGT TGTGCGTGCA CGGTGGCCTG AGTCCCGAGA TCATTACACT 
0481 GGACCAGATC AGGACGATCG ATCG 
 in silico PCR Fragment
0001 AAATGCAAGT ACCTGCCGGA GAACGAGCTG AAGAAGCTAT GCGAGATGGT CTGCGATATC 
0061 CTCCTGGAGG AG-ACGAACA TCCTGCCCGT GAGCACGCCC GTCACCGTTT GCGGTGACAT 
0121 C-CATGGCCA GTTCTACGAC CTGGAGCAGC TGTTCCGCAC TGGAGGCCAG GTGCCGC-AT 
0181 ACCAACTACA TATTCATGGG CGACTTCGTG GACAGGGGCT ACTACTCGCT GGAGACATTC 
0241 ACCAGACTGC TCACGCTGAA GGCGCGC-TA TCCCAGCCGG ATCACCCTGC TGCGCGGCAA 
0301 CCACGAAACG CGGCAGATCA CCAAGGTGTA CGGATTCTTT GACGAGTGCT TCAGCAAGTA 
0361 CGGCAATGCC AATGGCTGGA AATACTGCTG CAAGGTCTTC GATTTGCTTA CCATCGCTGC 
0421 CATCATCGAC GAGGAGGTGT TGTGCGTGCA CGGTGGCCTG AGTCCCGAGA TCATTACACT 
0481 GGACCAGATC AGGACGATCG ATCG 
 Assemble Data

12217R-2.IR_full       1   AAATGCAAGTACCTGCCGGAGAACGAGCTGAAGAAGCTATGCGAGATGGTCTGCGATATC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12217R-2.in silico     1   AAATGCAAGTACCTGCCGGAGAACGAGCTGAAGAAGCTATGCGAGATGGTCTGCGATATC 60


12217R-2.IR_full       61  CTCCTGGAGGAGAACGAACATCCTGCCCGTGAGCACGCCCGTCACCGTTTGCGGTGACAT 120
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
12217R-2.in silico     61  CTCCTGGAGGAG-ACGAACATCCTGCCCGTGAGCACGCCCGTCACCGTTTGCGGTGACAT 120


12217R-2.IR_full       121 CNCATGGCCAGTTCTACGACCTGGAGCAGCTGTTCCGCACTGGAGGCCAGGTGCCGCNAT 180
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
12217R-2.in silico     121 C-CATGGCCAGTTCTACGACCTGGAGCAGCTGTTCCGCACTGGAGGCCAGGTGCCGC-AT 180


12217R-2.IR_full       181 ACCAACTACATATTCATGGGCGACTTCGTGGACAGGGGCTACTACTCGCTGGAGACATTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12217R-2.in silico     181 ACCAACTACATATTCATGGGCGACTTCGTGGACAGGGGCTACTACTCGCTGGAGACATTC 240


12217R-2.IR_full       241 ACCAGACTGCTCACGCTGAAGGCGCGCTTATCCCAGCCGGATCACCCTGCTGCGCGGCAA 300
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
12217R-2.in silico     241 ACCAGACTGCTCACGCTGAAGGCGCGC-TATCCCAGCCGGATCACCCTGCTGCGCGGCAA 300


12217R-2.IR_full       301 CCACGAGACGCGGCAGATCACCAAGGTGTACGGATTCTTTGACGAGTGCTTCAGCAAGTA 360
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
12217R-2.in silico     301 CCACGAAACGCGGCAGATCACCAAGGTGTACGGATTCTTTGACGAGTGCTTCAGCAAGTA 360


12217R-2.IR_full       361 CGGCAATGCCAATGGCTGGAAATACTGCTGCAAGGTCTTCGATTTGCTTACCATCGCTGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12217R-2.in silico     361 CGGCAATGCCAATGGCTGGAAATACTGCTGCAAGGTCTTCGATTTGCTTACCATCGCTGC 420


12217R-2.IR_full       421 CATCATCGACGAGGAGGTGTTGTGCGTGCACGGTGGCCTGAGTCCCGAGATCATTACACT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12217R-2.in silico     421 CATCATCGACGAGGAGGTGTTGTGCGTGCACGGTGGCCTGAGTCCCGAGATCATTACACT 480


12217R-2.IR_full       481 GGACCAGATCAGGACGATCGATCG 504
                           ||||||||||||||||||||||||
12217R-2.in silico     481 GGACCAGATCAGGACGATCGATCG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078506.2  CG12217-RA (PpV), mRNA 
1.03   11  24  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
1.03   11  24  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0.82   16  16  NM_080198.2  CG5650-RA (Pp1-87B), mRNA 
0.62   13  25  NM_078649.2  CG9842-RA (Pp2B-14D), mRNA 
0   NM_176368.1  CG6571-RD, transcript variant D (rdgC), mRNA 
0   NM_176367.1  CG6571-RC, transcript variant C (rdgC), mRNA 
0   NM_176366.1  CG6571-RB, transcript variant B (rdgC), mRNA 
0   NM_080490.3  CG6571-RA, transcript variant A (rdgC), mRNA 
0   20  16  NM_079861.2  CG1455-RA (CanA1), mRNA 
0   19  65  NM_057457.3  CG7109-RA (mts), mRNA 
0   15  NM_080208.2  CG8822-RA (PpD6), mRNA 
0   12  NM_133004.1  CG8211-RA (CG8211), mRNA 
0   17  NM_079760.2  CG6593-RA (Pp1alpha-96A), mRNA 
0   NM_168496.1  CG4300-RA, transcript variant A (CG4300), mRNA 
0   NM_140308.2  CG4300-RB, transcript variant B (CG4300), mRNA 
0   NM_137849.2  CG3751-RA (RpS24), mRNA 
0   NM_205956.1  CG33302-RA (CG33302), mRNA 
0   NM_165580.2  CG8726-RA, transcript variant A (CG8726), mRNA 
0   NM_136497.3  CG8726-RB, transcript variant B (CG8726), mRNA 
0   NM_144062.1  CG11373-RA (CG11373), mRNA 
0   NM_143379.2  CG1647-RA (CG1647), mRNA 
0   32  38  NM_080064.2  CG32505-RA, transcript variant A (Pp4-19C), mRNA 
0   32  38  NM_167703.3  CG32505-RE, transcript variant E (Pp4-19C), mRNA 
0   10  NM_079999.2  CG2096-RB, transcript variant B (flw), mRNA 
0   10  NM_167229.1  CG2096-RA, transcript variant A (flw), mRNA 
0   NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_135236.2  CG10806-RB, transcript variant B (CG10806), mRNA 
0   NM_079713.2  CG6376-RA, transcript variant A (E2f), mRNA 
0   NM_164717.1  CG10806-RA, transcript variant A (CG10806), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
++ 
DC
++ 
DM
VM
+- 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.