National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12215R-1 
 Symbol KCNQ  Full Name KCNQ potassium channel 
 CG No CG33135  Old CG No CG12215 
 Synonyms CG12215, DKCNQ, CG12915, CG33135, KCNQ 
 Accession No (Link to NCBI) NM_176120.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGAACTACAACCGCGGCAC 
 Primer Seq. 3'
aatctagaggtaccCGTATACAACCGAGCCGAGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gCTGTAACTA CAACCGCGGC ACNCGNCGCG ATGTTCGCTN ACCGGCGCCT CCAGAGTCGC 
0061 CTCTACAACT TCCTGGAGCG GCcGCGCGGC CTGCNACGCC ATCTTCTACC ATGTGATGGT 
0121 ATTCCTGATG GTGTTCACCT GCCTGGCGCT CAGTGTGTTT TCCACCATCA AGGAGTACGA 
0181 AGAGGACGCC GTCTACATTC TGTTCCGCAT GGAGATCCTG GTGGTTATCT GGTTCACAAT 
0241 GGAGTTTGGA GCTCGACTCT GGTCATCGGG CTGCCGATCG CGATACCAGG GATGCCTGGG 
0301 TCGACTGAAG TTCGTGAAGC GACCATTCTG TATTATAGAT ATTGTCACCA TTTTAGCCTC 
0361 AATTGTAGTA TTAGGAATGG GCACCTCGGG CCAGGTGTTC GCCACGAGTG CTTTACGTGG 
0421 CCTCCGGTTC TTTCAGATCC TTCGGATGGT GCGCATGGAT CGGCGGGGCG GCACCTGGAA 
0481 GCTGCTCGGC TCGGTTGTAT ACG 
 in silico PCR Fragment
0001 GCTG-AACTA CAACCGCGGC ACCCGCCGCG ATGTTCGCT- ACCGGCGCCT CCAGAGTCGC 
0061 CTCTACAACT TCCTGGAGCG GCCGCGCGGC CTGC-ACGCC ATCTTCTACC ATGTGATGGT 
0121 ATTCCTGATG GTGTTCACCT GCCTGGCGCT CAGTGTGTTT TCCACCATCA AGGAGTACGA 
0181 AGAGGACGCC GTCTACATTC TGTTCCGCAT GGAGATCCTG GTGGTTATCT GGTTCACAAT 
0241 GGAGTTTGGA GCTCGACTCT GGTCATCGGG CTGCCGATCG CGATACCAGG GATGCCTGGG 
0301 TCGACTGAAG TTCGTGAAGC GACCATTCTG TATTATAGAT ATTGTCACCA TTTTAGCCTC 
0361 AATTGTAGTA TTAGGAATGG GCACCTCGGG CCAGGTGTTC GCCACGAGTG CTTTACGTGG 
0421 CCTCCGGTTC TTTCAGATCC TTCGGATGGT GCGCATGGAT CGGCGGGGCG GCACCTGGAA 
0481 GCTGCTCGGC TCGGTTGTAT ACG 
 Assemble Data

12215R-1.IR_full       1   GCTGTAACTACAACCGCGGCACNCGNCGCGATGTTCGCTNACCGGCGCCTCCAGAGTCGC 60
                           |||| ||||||||||||||||| || ||||||||||||| ||||||||||||||||||||
12215R-1.in silico     1   GCTG-AACTACAACCGCGGCACCCGCCGCGATGTTCGCT-ACCGGCGCCTCCAGAGTCGC 60


12215R-1.IR_full       61  CTCTACAACTTCCTGGAGCGGCCGCGCGGCCTGCNACGCCATCTTCTACCATGTGATGGT 120
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
12215R-1.in silico     61  CTCTACAACTTCCTGGAGCGGCCGCGCGGCCTGC-ACGCCATCTTCTACCATGTGATGGT 120


12215R-1.IR_full       121 ATTCCTGATGGTGTTCACCTGCCTGGCGCTCAGTGTGTTTTCCACCATCAAGGAGTACGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12215R-1.in silico     121 ATTCCTGATGGTGTTCACCTGCCTGGCGCTCAGTGTGTTTTCCACCATCAAGGAGTACGA 180


12215R-1.IR_full       181 AGAGGACGCCGTCTACATTCTGTTCCGCATGGAGATCCTGGTGGTTATCTGGTTCACAAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12215R-1.in silico     181 AGAGGACGCCGTCTACATTCTGTTCCGCATGGAGATCCTGGTGGTTATCTGGTTCACAAT 240


12215R-1.IR_full       241 GGAGTTTGGAGCTCGACTCTGGTCATCGGGCTGCCGATCGCGATACCAGGGATGCCTGGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12215R-1.in silico     241 GGAGTTTGGAGCTCGACTCTGGTCATCGGGCTGCCGATCGCGATACCAGGGATGCCTGGG 300


12215R-1.IR_full       301 TCGACTGAAGTTCGTGAAGCGACCATTCTGTATTATAGATATTGTCACCATTTTAGCCTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12215R-1.in silico     301 TCGACTGAAGTTCGTGAAGCGACCATTCTGTATTATAGATATTGTCACCATTTTAGCCTC 360


12215R-1.IR_full       361 AATTGTAGTATTAGGAATGGGCACCTCGGGCCAGGTGTTCGCCACGAGTGCTTTACGTGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12215R-1.in silico     361 AATTGTAGTATTAGGAATGGGCACCTCGGGCCAGGTGTTCGCCACGAGTGCTTTACGTGG 420


12215R-1.IR_full       421 CCTCCGGTTCTTTCAGATCCTTCGGATGGTGCGCATGGATCGGCGGGGCGGCACCTGGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12215R-1.in silico     421 CCTCCGGTTCTTTCAGATCCTTCGGATGGTGCGCATGGATCGGCGGGGCGGCACCTGGAA 480


12215R-1.IR_full       481 GCTGCTCGGCTCGGTTGTATACG 503
                           |||||||||||||||||||||||
12215R-1.in silico     481 GCTGCTCGGCTCGGTTGTATACG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176119.2  CG33135-RB, transcript variant B (KCNQ), mRNA 
100   482  NM_176120.2  CG33135-RA, transcript variant A (KCNQ), mRNA 
0   NM_134960.2  CG2818-RA, transcript variant A (CG2818), mRNA 
0   NM_164553.1  CG2818-RB, transcript variant B (CG2818), mRNA 
0   NM_079685.2  CG4451-RA (Hs6st), mRNA 
0   NM_141026.1  CG10566-RA (CG10566), mRNA 
0   NM_131952.1  CG3009-RA (CG3009), mRNA 
0   NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   NM_206597.1  CG4122-RF, transcript variant F (svr), mRNA 
0   NM_143402.2  CG1420-RA (CG1420), mRNA 
0   NM_164315.2  CG12582-RB, transcript variant B (CG12582), mRNA 
0   NM_141179.2  CG12582-RA, transcript variant A (CG12582), mRNA 
0   NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_058100.3  CG6521-RA (Stam), mRNA 
0   NM_132974.1  CG5162-RA (CG5162), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 
0   NM_131945.1  CG12684-RA (CG12684), mRNA 
0   NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   NM_135216.2  CG11070-RA (CG11070), mRNA 
0   NM_132659.2  CG1998-RA (CG1998), mRNA 
0   NM_141829.2  CG14709-RA (CG14709), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_138206.1  CG3371-RA (CG3371), mRNA 
0   NM_142783.2  CG13849-RA (Nop56), mRNA 
0   NM_001015183.1  CG40497-PA.3 (CG40497), mRNA 
0   NM_001015182.1  CG40497-PB.3 (CG40497), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.