National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12214R-3 
 Symbol CG12214  Full Name CG12214 
 CG No CG12214  Old CG No CG12214 
 Synonyms CG12214 
 Accession No (Link to NCBI) NM_136718.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTCCCTTTTGGAGGCGCTGG 
 Primer Seq. 3'
aatctagaggtaccGAGATGCAGTTCCTGGAGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTTCCCTTTT GGAGGCGCTG GAGCGCAAGT ACTTCGCAGA ATGCGAATTC GAGAATGCCC 
0061 ACCAACCGGA ACTCCACAAA CGAAGCGACC TGCCCAATGA CTTTACGGTC ACCAAGTGCG 
0121 GCGGACGCAT GGAGTTCTCC ATCTTCATAC CCCGCCTATC CCCGCTGACC AGTGTGCCAG 
0181 CCTTGCTAGT CCTCAACGAC TGTGACATCG ATTCGGCCGG GGACTTCGAC AGCATCCGGG 
0241 AGAAGTGCCA GCGGGTGAGG GAATTGGATC TGGCCCAGAA CAAGCTGAGC GACTGGTCGG 
0301 AGGTCTTCAG CATACTGGAG CACATGCCGC GCATCGAGTT CCTCAACCTG AGCAAGAACC 
0361 AGCTGGCCAG TCCGATCGGC ACGTTGCCCA CGGCTCCCAC GATCAATCTG AAGAGCCTGG 
0421 TGCTGAACGG CACCTACTTG GACTGGGCCT GCGTGGATAC CCTGCTGAAG AATTTGCCCG 
0481 TGCTCCAGGA ACTGCATCTC  
 in silico PCR Fragment
0001 CTTCCCTTTT GGAGGCGCTG GAGCGCAAGT ACTTCGCAGA ATGCGAATTC GAGAATGCCC 
0061 ACCAACCGGA ACTCCACAAA CGAAGCGACC TGCCCAATGA CTTTACGGTC ACCAAGTGCG 
0121 GCGGACGCAT GGAGTTCTCC ATCTTCATAC CCCGCCTATC CCCGCTGACC AGTGTGCCAG 
0181 CCTTGCTAGT CCTCAACGAC TGTGACATCG ATTCGGCCGG GGACTTCGAC AGCATCCGGG 
0241 AGAAGTGCCA GCGGGTGAGG GAACTGGATC TGGCCCAGAA CAAGCTGAGC GACTGGTCGG 
0301 AGGTCTTCAG CATACTGGAG CACATGCCGC GCATTGAGTT CCTCAACCTG AGCAAGAACC 
0361 AGCTGGCCAG TCCGATCGGC ACGTTGCCCA CGGCTCCCAC GATCAATCTG AAGAGCCTGG 
0421 TGCTGAACGG CACCTACTTG GACTGGGCCT GCGTGGATAC CCTGCTGAAG AATTTGCCCG 
0481 TGCTCCAGGA ACTGCATCTC  
 Assemble Data

12214R-3.IR_full       1   CTTCCCTTTTGGAGGCGCTGGAGCGCAAGTACTTCGCAGAATGCGAATTCGAGAATGCCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12214R-3.in silico     1   CTTCCCTTTTGGAGGCGCTGGAGCGCAAGTACTTCGCAGAATGCGAATTCGAGAATGCCC 60


12214R-3.IR_full       61  ACCAACCGGAACTCCACAAACGAAGCGACCTGCCCAATGACTTTACGGTCACCAAGTGCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12214R-3.in silico     61  ACCAACCGGAACTCCACAAACGAAGCGACCTGCCCAATGACTTTACGGTCACCAAGTGCG 120


12214R-3.IR_full       121 GCGGACGCATGGAGTTCTCCATCTTCATACCCCGCCTATCCCCGCTGACCAGTGTGCCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12214R-3.in silico     121 GCGGACGCATGGAGTTCTCCATCTTCATACCCCGCCTATCCCCGCTGACCAGTGTGCCAG 180


12214R-3.IR_full       181 CCTTGCTAGTCCTCAACGACTGTGACATCGATTCGGCCGGGGACTTCGACAGCATCCGGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12214R-3.in silico     181 CCTTGCTAGTCCTCAACGACTGTGACATCGATTCGGCCGGGGACTTCGACAGCATCCGGG 240


12214R-3.IR_full       241 AGAAGTGCCAGCGGGTGAGGGAATTGGATCTGGCCCAGAACAAGCTGAGCGACTGGTCGG 300
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
12214R-3.in silico     241 AGAAGTGCCAGCGGGTGAGGGAACTGGATCTGGCCCAGAACAAGCTGAGCGACTGGTCGG 300


12214R-3.IR_full       301 AGGTCTTCAGCATACTGGAGCACATGCCGCGCATCGAGTTCCTCAACCTGAGCAAGAACC 360
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
12214R-3.in silico     301 AGGTCTTCAGCATACTGGAGCACATGCCGCGCATTGAGTTCCTCAACCTGAGCAAGAACC 360


12214R-3.IR_full       361 AGCTGGCCAGTCCGATCGGCACGTTGCCCACGGCTCCCACGATCAATCTGAAGAGCCTGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12214R-3.in silico     361 AGCTGGCCAGTCCGATCGGCACGTTGCCCACGGCTCCCACGATCAATCTGAAGAGCCTGG 420


12214R-3.IR_full       421 TGCTGAACGGCACCTACTTGGACTGGGCCTGCGTGGATACCCTGCTGAAGAATTTGCCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12214R-3.in silico     421 TGCTGAACGGCACCTACTTGGACTGGGCCTGCGTGGATACCCTGCTGAAGAATTTGCCCG 480


12214R-3.IR_full       481 TGCTCCAGGAACTGCATCTC 500
                           ||||||||||||||||||||
12214R-3.in silico     481 TGCTCCAGGAACTGCATCTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165754.1  CG12214-RB, transcript variant B (CG12214), mRNA 
100   482  NM_136718.2  CG12214-RA, transcript variant A (CG12214), mRNA 
0   NM_140023.2  CG5093-RA (Doc3), mRNA 
0   NM_166059.1  CG30076-RA (CG30076), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_143888.4  CG14476-RB, transcript variant B (CG14476), mRNA 
0   NM_167758.1  CG14476-RC, transcript variant C (CG14476), mRNA 
0   NM_167760.1  CG14476-RE, transcript variant E (CG14476), mRNA 
0   NM_167759.1  CG14476-RD, transcript variant D (CG14476), mRNA 
0   NM_167757.1  CG14476-RA, transcript variant A (CG14476), mRNA 
0   11  NM_143497.2  CG7896-RA (CG7896), mRNA 
0   NM_001043154.1  CG7437-RD, transcript variant D (mub), mRNA 
0   NM_165431.1  CG30437-RA, transcript variant A (CG30437), mRNA 
0   NM_136326.1  CG30437-RC, transcript variant C (CG30437), mRNA 
0   NM_165432.1  CG30437-RB, transcript variant B (CG30437), mRNA 
0   NM_168568.2  CG8937-RC, transcript variant C (Hsc70-1), mRNA 
0   NM_079339.2  CG8937-RA, transcript variant A (Hsc70-1), mRNA 
0   NM_079484.4  CG7437-RA, transcript variant A (mub), mRNA 
0   NM_168946.3  CG7437-RB, transcript variant B (mub), mRNA 
0   NM_206423.2  CG7437-RC, transcript variant C (mub), mRNA 
0   NM_168569.1  CG8937-RD, transcript variant D (Hsc70-1), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_080531.2  CG5481-RA (lea), mRNA 
0   NM_137077.2  CG13350-RA (CG13350), mRNA 
0   NM_144353.2  CG7626-RA, transcript variant A (Spt5), mRNA 
0   NM_206167.1  CG7626-RB, transcript variant B (Spt5), mRNA 
0   NM_141829.2  CG14709-RA (CG14709), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.