National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12201Ra-2 
 Symbol GC2  Full Name Glutamate Carrier 2 
 CG No CG12201  Old CG No CG12201 
 Synonyms CG12201,DmGC2,GC2,Glutamate Carrier 2 
 Accession No (Link to NCBI) NM_141878.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGTTAAGACGCGACTGCAA 
 Primer Seq. 3'
aatctagaggtaccATCCAGGCCATTAGCGGAAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGTTAAGA CGCGACTGCA AAANNNANNA ATNNNNNNNN NTNGNNNGNN NNNNTNNANN 
0061 NGCATGNGNN TNTNNNCTNN NNNNNNNNNN NNCGNNNNNG NNNNNNCNNN NNTNNNNTCC 
0121 NNNTNANGNG NNNNTNTANN NCNNNANCGC CGACTGTTTC CGAAAGACTA TCGCCAGCGA 
0181 AGGCTATTTT GGAATGTACA GAGGCTCAGC GGTGAACATC GTGCTGATTA CGCCCGAGAA 
0241 AGCCATCAAG TTGACCGCCA ACGACTTCTT TCGGTATCAT CTGGCATCCG ATGACGGGGT 
0301 TATTCCGTTG TCACGGGCTA CTTTGGCCGG GGGNCTGGCC GGGCTATTCC AGATCGTGGT 
0361 CACCACGCCC ATGGAGCTCC TCAAGATACA GATGCAGGAC GCCGGGCGGG TGGCTGNNTC 
0421 CGACCGAGCG GCAGGACGAG AGGTGAAAAC TATAACGGCC TTGGGTCTGA CCAAGACGCT 
0481 CCTTCGTGAG CGTGGAATCT TCGGTTTATA CAAGGGTGTG GGCGCCACTG GAGTGCGGGA 
0541 TATTACGTTC TCGATGGTGT ACTTTCCGCT AATGGCCTGG AT 
 in silico PCR Fragment
0001 ATGGTTAAGA CGCGACTGCA AAACCAAACA ATAGGTCCCA ATGGAGAGCG CATGTACACC 
0061 AGCATAACTC TATTGCCTTA GCGCCGACTG TTTCCGAAAG ACTATCGCCA GCGAAGGCTA 
0121 TTTTGGAATG TACAGAGGCT CAGCGGTGAA CATCGTGCTG ATTACGCCCG AGAAAGCCAT 
0181 CAAGTTGACC GCCAACGACT TCTTTCGGTA TCATCTGGCA TCCGATGACG GGGTTATTCC 
0241 GTTGTCACGG GCTACTTTGG CCGGGGGCCT GGCCGGGCTA TTCCAGATCG TGGTCACCAC 
0301 GCCCATGGAG CTCCTCAAGA TACAGATGCA GGACGCCGGG CGGGTGGCTG CTGCCGACCG 
0361 AGCGGCAGGA CGAGAGGTGA AAACTATAAC GGCCTTGGGT CTGACCAAGA CGCTCCTTCG 
0421 TGAGCGTGGA ATCTTCGGTT TATACAAGGG TGTGGGCGCC ACTGGAGTGC GGGATATTAC 
0481 GTTCTCGATG GTGTACTTTC CGCTAATGGC CTGGAT 
 Assemble Data

12201Ra-2.IR full       1   ATGGTTAAGACGCGACTGCAAAANNNANNAATNNNNNNNNNTNGNNNGNNNNNNTNNANN 60
                                                                                        
12201Ra-2.in silico     1   ------------------------------------------------------------ 60


12201Ra-2.IR full        61  GCATGNGNNTNTNNNCTNNNNNNNNNNNNNNCGNNNNNGNNNNNNCNNNNNTNNNNTCC 119
                                   |  |                            |                 |  
12201Ra-2.in silico      61  ----ATGGTTAAGACGCGACTGCAAAACCAAACAATAGGTCCCAATGGAGAGCGCATGT 119


12201Ra-2.IR full        NN121 TNANGNGNNNNTNTANNNCNNNANCGCCGACTGTTTCCGAAAGACTATCGCCAGCGA 176
                                 |        | ||   |   | |||||||||||||||||||||||||||||||||
12201Ra-2.in silico      AC121 CCAG-CATAACTCTATTGCCTTAGCGCCGACTGTTTCCGAAAGACTATCGCCAGCGA 176


12201Ra-2.IR full       181 AGGCTATTTTGGAATGTACAGAGGCTCAGCGGTGAACATCGTGCTGATTACGCCCGAGAA 236
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12201Ra-2.in silico     181 AGGCTATTTTGGAATGTACAGAGGCTCAGCGGTGAACATCGTGCTGATTACGCCCGAGAA 236


12201Ra-2.IR full       241 AGCCATCAAGTTGACCGCCAACGACTTCTTTCGGTATCATCTGGCATCCGATGACGGGGT 296
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12201Ra-2.in silico     241 AGCCATCAAGTTGACCGCCAACGACTTCTTTCGGTATCATCTGGCATCCGATGACGGGGT 296


12201Ra-2.IR full       301 TATTCCGTTGTCACGGGCTACTTTGGCCGGGGGNCTGGCCGGGCTATTCCAGATCGTGGT 356
                            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
12201Ra-2.in silico     301 TATTCCGTTGTCACGGGCTACTTTGGCCGGGGGCCTGGCCGGGCTATTCCAGATCGTGGT 356


12201Ra-2.IR full       361 CACCACGCCCATGGAGCTCCTCAAGATACAGATGCAGGACGCCGGGCGGGTGGCTGNNTC 416
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |
12201Ra-2.in silico     361 CACCACGCCCATGGAGCTCCTCAAGATACAGATGCAGGACGCCGGGCGGGTGGCTGCTGC 416


12201Ra-2.IR full       421 CGACCGAGCGGCAGGACGAGAGGTGAAAACTATAACGGCCTTGGGTCTGACCAAGACGCT 476
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12201Ra-2.in silico     421 CGACCGAGCGGCAGGACGAGAGGTGAAAACTATAACGGCCTTGGGTCTGACCAAGACGCT 476


12201Ra-2.IR full       481 CCTTCGTGAGCGTGGAATCTTCGGTTTATACAAGGGTGTGGGCGCCACTGGAGTGCGGGA 536
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12201Ra-2.in silico     481 CCTTCGTGAGCGTGGAATCTTCGGTTTATACAAGGGTGTGGGCGCCACTGGAGTGCGGGA 536


12201Ra-2.IR full       541 TATTACGTTCTCGATGGTGTACTTTCCGCTAATGGCCTGGAT 578
                            ||||||||||||||||||||||||||||||||||||||||||
12201Ra-2.in silico     541 TATTACGTTCTCGATGGTGTACTTTCCGCTAATGGCCTGGAT 578

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169443.2  CG12201-RB, transcript variant B (CG12201), mRNA 
96.26   464  NM_141878.2  CG12201-RA, transcript variant A (CG12201), mRNA 
1.45   21  30  43  NM_141877.1  CG18347-RA (CG18347), mRNA 
0   NM_140023.2  CG5093-RA (Doc3), mRNA 
0   NM_143605.2  CG11339-RA (CG11339), mRNA 
0   NM_143015.2  CG13625-RA (CG13625), mRNA 
0   NM_167946.1  CG32299-RA (CG32299), mRNA 
0   10  NM_170485.1  CG2139-RC, transcript variant C (aralar1), mRNA 
0   10  NM_170487.1  CG2139-RB, transcript variant B (aralar1), mRNA 
0   10  NM_143538.2  CG2139-RA, transcript variant A (aralar1), mRNA 
0   10  NM_170486.1  CG2139-RD, transcript variant D (aralar1), mRNA 
0   NM_078729.2  CG12193-RA (Or22a), mRNA 
0   NM_078544.2  CG1689-RA (lz), mRNA 
0   NM_078700.2  CG1849-RA (run), mRNA 
0   NM_139548.2  CG12016-RA, transcript variant A (CG12016), mRNA 
0   NM_168022.1  CG12016-RB, transcript variant B (CG12016), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   NM_140094.1  CG14174-RA (CG14174), mRNA 
0   NM_139719.2  CG10592-RA (CG10592), mRNA 
0   NM_169275.1  CG8874-RC, transcript variant C (Fps85D), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.