National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12201Ra-1 
 Symbol GC2  Full Name Glutamate Carrier 2 
 CG No CG12201  Old CG No CG12201 
 Synonyms CG12201,DmGC2,GC2,Glutamate Carrier 2 
 Accession No (Link to NCBI) NM_141878.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                                                                                silico     1   ------------------------------------------------------------ 60

                                   |  |                            |                 | silico      61  ----ATGGTTAAGACGCGACTGCAAAACCAAACAATAGGTCCCAATGGAGAGCGCATGT 119

                                 |        | ||   |   | ||||||||||||||||||||||||||||||||| silico      AC121 CCAG-CATAACTCTATTGCCTTAGCGCCGACTGTTTCCGAAAGACTATCGCCAGCGA 176

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGCTATTTTGGAATGTACAGAGGCTCAGCGGTGAACATCGTGCTGATTACGCCCGAGAA 236

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCCATCAAGTTGACCGCCAACGACTTCTTTCGGTATCATCTGGCATCCGATGACGGGGT 296

                            ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     301 TATTCCGTTGTCACGGGCTACTTTGGCCGGGGGCCTGGCCGGGCTATTCCAGATCGTGGT 356

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   | silico     361 CACCACGCCCATGGAGCTCCTCAAGATACAGATGCAGGACGCCGGGCGGGTGGCTGCTGC 416

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGACCGAGCGGCAGGACGAGAGGTGAAAACTATAACGGCCTTGGGTCTGACCAAGACGCT 476

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     481 CCTTCGTGAGCGTGGAATCTTCGGTTTATACAAGGGTGTGGGCGCCACTGGAGTGCGGGA 536

                            |||||||||||||||||||||||||||||||||||||||||| silico     541 TATTACGTTCTCGATGGTGTACTTTCCGCTAATGGCCTGGAT 578

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169443.2  CG12201-RB, transcript variant B (CG12201), mRNA 
96.26   464  NM_141878.2  CG12201-RA, transcript variant A (CG12201), mRNA 
1.45   21  30  43  NM_141877.1  CG18347-RA (CG18347), mRNA 
0   NM_140023.2  CG5093-RA (Doc3), mRNA 
0   NM_143605.2  CG11339-RA (CG11339), mRNA 
0   NM_143015.2  CG13625-RA (CG13625), mRNA 
0   NM_167946.1  CG32299-RA (CG32299), mRNA 
0   10  NM_170485.1  CG2139-RC, transcript variant C (aralar1), mRNA 
0   10  NM_170487.1  CG2139-RB, transcript variant B (aralar1), mRNA 
0   10  NM_143538.2  CG2139-RA, transcript variant A (aralar1), mRNA 
0   10  NM_170486.1  CG2139-RD, transcript variant D (aralar1), mRNA 
0   NM_078729.2  CG12193-RA (Or22a), mRNA 
0   NM_078544.2  CG1689-RA (lz), mRNA 
0   NM_078700.2  CG1849-RA (run), mRNA 
0   NM_139548.2  CG12016-RA, transcript variant A (CG12016), mRNA 
0   NM_168022.1  CG12016-RB, transcript variant B (CG12016), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   NM_140094.1  CG14174-RA (CG14174), mRNA 
0   NM_139719.2  CG10592-RA (CG10592), mRNA 
0   NM_169275.1  CG8874-RC, transcript variant C (Fps85D), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.