National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12191R-2 
 Symbol dpr20  Full Name dpr20 
 CG No CG12191  Old CG No CG12191 
 Synonyms CG12191, Dpr-20, CT9818, dpr20 
 Accession No (Link to NCBI) NM_138222.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAATGAACCAGCTGCAAGAAC 
 Primer Seq. 3'
aatctagaggtaccTCTTCTTGTGTCCGGACGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAATGAACCA GCTGCAAGAA CGCGACCCAG AACTAAATCA ACGACAGACG CCACCAAGTT 
0061 CTCATCATCC AGGGGTGACC TTCACCTCGA TTGCGCCGTG CCCAACCTGA TCAGGCTGCT 
0121 CCTCCTCATC GCAACGATCA TGGGCTCCGG ACTCGTCCAG GCCAAGACAA TTTACGACTC 
0181 GGTTAACATG ATTCAGTCGC TGGATGCCTT GGTTGAGCCA CGGGACACGA CCAAGGTTCC 
0241 GCTGCAAACA ACGTCAGCCA CGCCCCCCAC TGCCCACGCC CACATCCACA ACCAGGTGTN 
0301 CCACGTTACG GAGTAGTTAC GAGGATTCAG ATGATGGCGT AGATGGCGAT TATGTCATCC 
0361 CAGAGAGCCA GACATCTACG GTGGCGATCC TGGACCAGGA TTCCTCCATG AAGGGCCAGG 
0421 ACATGGAATC GTTATCCCTG CAGGCAGGAT CGGGCACAGT TTCACCAAAG AGCAGCCCCG 
0481 ATTCGTCCGG ACACAAGAAG A 
 in silico PCR Fragment
0001 GAATGAACCA GCTGCAAGAA CGCGACCCAG AACTAAATCA ACGACAGACG CCACCAAGTT 
0061 CTCATCATCC AGGGGTGACC TTCACCTCGA TTGCGCCGTG CCCAACCTGA TCAGGCTGCT 
0121 CCTCCTCATC GCAACGATCA TGGGCTCCGG ACTCGTCCAG GCCAAGACAA TTTACGACTC 
0181 GGTTAACATG ATTCAGTCGC TGGATGCCTT GGTTGAGCCA CGGGAAACGA CCAAGGTTCC 
0241 GCTGCAAACA ACGCCAGCCA CGCCCCCCAC TGCCCACGCC CACATCCACA ACCAGGTGT- 
0301 CCACGTTACG GAGTAGTTAC GAGGATTCAG ATGATGGCGT AGATGGCGAT TATGTCATCC 
0361 CAGAGAGCCA GACATCTACG GTGGCGATCC TGGATCAGGA TTCCTCCATG AAGGGCCAGG 
0421 ACATGGAATC GTTATCCCTG CAGGCAGGAT CGGGCACAGT TTCACCAAAG AGCAGCCCCG 
0481 ATTCGTCCGG ACACAAGAAG A 
 Assemble Data

12191R-2.IR_full       1   GAATGAACCAGCTGCAAGAACGCGACCCAGAACTAAATCAACGACAGACGCCACCAAGTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12191R-2.in silico     1   GAATGAACCAGCTGCAAGAACGCGACCCAGAACTAAATCAACGACAGACGCCACCAAGTT 60


12191R-2.IR_full       61  CTCATCATCCAGGGGTGACCTTCACCTCGATTGCGCCGTGCCCAACCTGATCAGGCTGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12191R-2.in silico     61  CTCATCATCCAGGGGTGACCTTCACCTCGATTGCGCCGTGCCCAACCTGATCAGGCTGCT 120


12191R-2.IR_full       121 CCTCCTCATCGCAACGATCATGGGCTCCGGACTCGTCCAGGCCAAGACAATTTACGACTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12191R-2.in silico     121 CCTCCTCATCGCAACGATCATGGGCTCCGGACTCGTCCAGGCCAAGACAATTTACGACTC 180


12191R-2.IR_full       181 GGTTAACATGATTCAGTCGCTGGATGCCTTGGTTGAGCCACGGGACACGACCAAGGTTCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
12191R-2.in silico     181 GGTTAACATGATTCAGTCGCTGGATGCCTTGGTTGAGCCACGGGAAACGACCAAGGTTCC 240


12191R-2.IR_full       241 GCTGCAAACAACGTCAGCCACGCCCCCCACTGCCCACGCCCACATCCACAACCAGGTGTN 300
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| 
12191R-2.in silico     241 GCTGCAAACAACGCCAGCCACGCCCCCCACTGCCCACGCCCACATCCACAACCAGGTGT- 300


12191R-2.IR_full       301 CCACGTTACGGAGTAGTTACGAGGATTCAGATGATGGCGTAGATGGCGATTATGTCATCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12191R-2.in silico     301 CCACGTTACGGAGTAGTTACGAGGATTCAGATGATGGCGTAGATGGCGATTATGTCATCC 360


12191R-2.IR_full       361 CAGAGAGCCAGACATCTACGGTGGCGATCCTGGACCAGGATTCCTCCATGAAGGGCCAGG 420
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
12191R-2.in silico     361 CAGAGAGCCAGACATCTACGGTGGCGATCCTGGATCAGGATTCCTCCATGAAGGGCCAGG 420


12191R-2.IR_full       421 ACATGGAATCGTTATCCCTGCAGGCAGGATCGGGCACAGTTTCACCAAAGAGCAGCCCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12191R-2.in silico     421 ACATGGAATCGTTATCCCTGCAGGCAGGATCGGGCACAGTTTCACCAAAGAGCAGCCCCG 480


12191R-2.IR_full       481 ATTCGTCCGGACACAAGAAGA 501
                           |||||||||||||||||||||
12191R-2.in silico     481 ATTCGTCCGGACACAAGAAGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138222.2  CG12191-RA (dpr20), mRNA 
0.2   NM_176542.1  CG7029-RA (CG7029), mRNA 
0   NM_169882.1  CG4836-RB, transcript variant B (CG4836), mRNA 
0   NM_169883.1  CG4836-RA, transcript variant A (CG4836), mRNA 
0   NM_142599.1  CG4836-RC, transcript variant C (CG4836), mRNA 
0   NM_169884.1  CG31210-RA (CG31210), mRNA 
0   NM_132445.1  CG1567-RA (C901), mRNA 
0   NM_135466.2  CG17633-RA (CG17633), mRNA 
0   NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0   NM_170054.2  CG17894-RB, transcript variant B (cnc), mRNA 
0   NM_137166.3  CG7761-RA (pcs), mRNA 
0   NM_165353.2  CG9266-RB (CG9266), mRNA 
0   NM_176505.1  CG33207-RA, transcript variant A (pxb), mRNA 
0   NM_140258.2  CG7264-RA (CG7264), mRNA 
0   NM_139465.1  CG16762-RA (CG16762), mRNA 
0   NM_001043240.1  CG34114-RB (CG34114), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   NM_137748.2  CG10080-RA (CG10080), mRNA 
0   NM_135320.2  CG7093-RA (CG7093), mRNA 
0   NR_002097.1  CG7093-RA (CG7093), mRNA, miscRNA 
0   NM_140054.2  CG3743-RA, transcript variant A (MTF-1), mRNA 
0   NR_002098.1  CG3743-RA, transcript variant A (MTF-1), mRNA, miscRNA 
0   NM_168343.1  CG3743-RB, transcript variant B (MTF-1), mRNA 
0   NM_140924.2  CG7328-RA (CG7328), mRNA 
0   NM_079452.2  CG7395-RA (NPFR76F), mRNA 
0   NM_057661.2  CG5076-RA (elk), mRNA 
0   NM_079694.2  CG5460-RC, transcript variant C (H), mRNA 
0   NM_169907.1  CG5460-RA, transcript variant A (H), mRNA 
0   NM_140178.3  CG7828-RA (CG7828), mRNA 
0   NM_169908.1  CG5460-RD, transcript variant D (H), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.