National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12189R-3 
 Symbol Rev1  Full Name Rev1 
 CG No CG12189  Old CG No CG12189 
 Synonyms DmREV1, CG12189, AAF47401, drev1, DmRev1, dREV1, REV1, Rev1 
 Accession No (Link to NCBI) NM_138203.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTTGTGAACGGCCGGACTGA 
 Primer Seq. 3'
aatctagaggtaccTGCGAGCGGTGGTGGAGTTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATTTGTGAAC GGCCGGACTG ACCCTTCGGC GGATGAACTG AAGCGTATTA TGATGGTGCA 
0061 CGGCGGGACC TTTCACCACT ACGAAAGGAG CCACACGACG TACATAATAG CCTCCGTTCT 
0121 GCCCGATGTG AAGGTCAGGA ACATGAATCT CAGCAAGTTC ATCAGCGCCA AGTGGGTGGT 
0181 GGATTGTCTG GAGAAAAAGA AGATAGTAGA CTACAAACCC TATCTGCTGT ACACGAACCA 
0241 GAAGACATCG CAGCCCATGC TCATCTTTGG GAAACCCAAA GACAACGGCG CAAATGAGAG 
0301 CAAATCGGAT GTGGAGCCGC CGAAAGATAA AGCGGAAGTG GAAGTAGACT CTACAAAAGA 
0361 TGAAACGCAA ATGGAGTTGG GTGGCATTCT CAAGAATTTG CAGCAGGCTG TGGCTACTTC 
0421 GCCGGAAAAG GAGGCCAGTG CATCAGAGAG CAAGATCACA AACTTATCCA CCACCTCGAA 
0481 TAACTCCACC ACCGCTCGCA  
 in silico PCR Fragment
0001 ATTTGTGAAC GGCCGGACTG ACCCTTCGGC GGATGAACTG AAGCGTATTA TGATGGTGCA 
0061 CGGCGGGACC TTTCACCACT ACGAAAGGAG CCACACGACG TACATAATAG CCTCCGTTCT 
0121 GCCCGATGTG AAGGTCAGGA ACATGAATCT CAGCAAGTTC ATCAGCGCCA AGTGGGTGGT 
0181 GGATTGTCTG GAGAAAAAGA AGATAGTAGA CTACAAACCC TATCTGCTGT ACACGAACCA 
0241 GAAGACATCG CAGCCCATGC TCATCTTTGG GAAACCCAAA GACAACGGCG CAAATGAGAG 
0301 CAAATCGGAT GTGGAGCCGC CGAAAGATAA AGCGGAAGTG GAAGTAGACT CTACAAAAGA 
0361 TGAAACGCAA ATGGAGTTGG GTGGCATTCT CAAGAATTTG CAGCAGGCTG TGGCCACTTC 
0421 GCCGGAAAAG GAGGCCAGTG CATCAGAGAG CAAGATCACA AACTTATCCA CCACCTCGAA 
0481 TAACTCCACC ACCGCTCGCA  
 Assemble Data

12189R-3.IR_full       1   ATTTGTGAACGGCCGGACTGACCCTTCGGCGGATGAACTGAAGCGTATTATGATGGTGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12189R-3.in silico     1   ATTTGTGAACGGCCGGACTGACCCTTCGGCGGATGAACTGAAGCGTATTATGATGGTGCA 60


12189R-3.IR_full       61  CGGCGGGACCTTTCACCACTACGAAAGGAGCCACACGACGTACATAATAGCCTCCGTTCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12189R-3.in silico     61  CGGCGGGACCTTTCACCACTACGAAAGGAGCCACACGACGTACATAATAGCCTCCGTTCT 120


12189R-3.IR_full       121 GCCCGATGTGAAGGTCAGGAACATGAATCTCAGCAAGTTCATCAGCGCCAAGTGGGTGGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12189R-3.in silico     121 GCCCGATGTGAAGGTCAGGAACATGAATCTCAGCAAGTTCATCAGCGCCAAGTGGGTGGT 180


12189R-3.IR_full       181 GGATTGTCTGGAGAAAAAGAAGATAGTAGACTACAAACCCTATCTGCTGTACACGAACCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12189R-3.in silico     181 GGATTGTCTGGAGAAAAAGAAGATAGTAGACTACAAACCCTATCTGCTGTACACGAACCA 240


12189R-3.IR_full       241 GAAGACATCGCAGCCCATGCTCATCTTTGGGAAACCCAAAGACAACGGCGCAAATGAGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12189R-3.in silico     241 GAAGACATCGCAGCCCATGCTCATCTTTGGGAAACCCAAAGACAACGGCGCAAATGAGAG 300


12189R-3.IR_full       301 CAAATCGGATGTGGAGCCGCCGAAAGATAAAGCGGAAGTGGAAGTAGACTCTACAAAAGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12189R-3.in silico     301 CAAATCGGATGTGGAGCCGCCGAAAGATAAAGCGGAAGTGGAAGTAGACTCTACAAAAGA 360


12189R-3.IR_full       361 TGAAACGCAAATGGAGTTGGGTGGCATTCTCAAGAATTTGCAGCAGGCTGTGGCTACTTC 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
12189R-3.in silico     361 TGAAACGCAAATGGAGTTGGGTGGCATTCTCAAGAATTTGCAGCAGGCTGTGGCCACTTC 420


12189R-3.IR_full       421 GCCGGAAAAGGAGGCCAGTGCATCAGAGAGCAAGATCACAAACTTATCCACCACCTCGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12189R-3.in silico     421 GCCGGAAAAGGAGGCCAGTGCATCAGAGAGCAAGATCACAAACTTATCCACCACCTCGAA 480


12189R-3.IR_full       481 TAACTCCACCACCGCTCGCA 500
                           ||||||||||||||||||||
12189R-3.in silico     481 TAACTCCACCACCGCTCGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138203.2  CG12189-RA (Rev1), mRNA 
0   10  NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_141399.1  CG9727-RA (CG9727), mRNA 
0   NM_167239.2  CG32677-RA (CG32677), mRNA 
0   NM_139641.2  CG7447-RA, transcript variant A (CG7447), mRNA 
0   NM_176283.1  CG7447-RB, transcript variant B (CG7447), mRNA 
0   NM_142051.2  CG9345-RA (Adgf-C), mRNA 
0   NM_136954.2  CG8594-RA (CG8594), mRNA 
0   NM_136457.2  CG1358-RA, transcript variant A (CG1358), mRNA 
0   NM_165545.1  CG1358-RB, transcript variant B (CG1358), mRNA 
0   NM_165546.1  CG1358-RC, transcript variant C (CG1358), mRNA 
0   NM_137051.1  CG13337-RA (CG13337), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_137314.2  CG5522-RC, transcript variant C (CG5522), mRNA 
0   NM_166193.1  CG5522-RA, transcript variant A (CG5522), mRNA 
0   NM_166194.1  CG5522-RB, transcript variant B (CG5522), mRNA 
0   NM_166197.1  CG5522-RF, transcript variant F (CG5522), mRNA 
0   NM_166195.1  CG5522-RE, transcript variant E (CG5522), mRNA 
0   NM_166196.1  CG5522-RD, transcript variant D (CG5522), mRNA 
0   NM_169698.1  CG5000-RA (msps), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_142086.2  CG9649-RA (CG9649), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_144376.2  CG1656-RA (lectin-46Ca), mRNA 
0   NM_137120.1  CG17386-RA (CG17386), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_165355.1  CG9256-RA, transcript variant A (Nhe2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.