National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12172R-1 
 Symbol Spn43Aa  Full Name Serine protease inhibitor 43Aa 
 CG No CG12172  Old CG No CG12172 
 Synonyms Ser1, SER1, anon-WO0118057.1, CG12172, Spn43Aa 
 Accession No (Link to NCBI) NM_080066.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATTCTTCTTGGGGTGTGGAT 
 Primer Seq. 3'
aatctagaggtaccTGTCCGGCTCCAGGCTTTCCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATTCTTCTT GGGGTGTGGA TATCCGCTCC TGAAGGTCTG GGTAACACGA TCAAGGATCG 
0061 CAATCTCTTC GCCACCGAAC TCTTCCAAAC CCTCGCCACA GATCGCCAGG ATGAGAACGT 
0121 GATCATCTCG CCGGTTTCCA TCCAGCTGGC CCTCGGGTTG GCTTACTACG GAGCTGAGGG 
0181 CAGGACGGCC GCGGAACTGC AGAAGACCTT GCACGCCTCC GCCAAGGAGA GCAAAGATGG 
0241 TCTGGCCGAG AGCTACCACA ACCTGCTGCA CTCTTACATC AAGTCCAAGA CCGTGTTGGA 
0301 GATCGCCAAC AAGGTGTACA CCCGGCAGAA TCTCACGGTA TCTAGCCACT TCCGAGAGGT 
0361 GGCCCAGAAG TACTTCGACT CCGAGGTAGA ACCACTGGAC TTCAGTCGCG AAACGGAGGC 
0421 CGTGGAGCAG ATCAACCGCT GGGTGAAGCA GCAGACGGAG AACAAGATCG AACGGGTGGT 
0481 GGAAAGCCTG GAGCCGGACA  
 in silico PCR Fragment
0001 CATTCTTCTT GGGGTGTGGA TATCCGCTCC TGAAGGTCTG GGTAACACGA TCAAGGATCG 
0061 CAATCTCTTC GCCACCGAAC TCTTCCAAAC CCTCGCCACA GATCGCCAGG ATGAGAACGT 
0121 GATCATCTCG CCGGTTTCCA TCCAGCTGGC CCTCGGGTTG GCTTACTACG GAGCTGAGGG 
0181 CAGGACGGCC GCGGAACTGC AGAAGACCTT GCACGCCTCC GCCAAGGAGA GCAAAGATGG 
0241 TCTGGCCGAG AGCTACCACA ACCTGCTGCA CTCTTACATC AAGTCCAAGA CCGTGTTGGA 
0301 GATCGCCAAC AAGGTGTACA CCCGGCAGAA TCTCACGGTA TCTAGCCACT TCCGAGAGGT 
0361 GGCCCAGAAG TACTTCGACT CCGAGGTAGA ACCACTGGAC TTCAGTCGCG AAACGGAGGC 
0421 CGTGGAGCAG ATCAACCGCT GGGTGAAGCA GCAGACGGAG AACAAGATCG AACGGGTGGT 
0481 GGAAAGCCTG GAGCCGGACA  
 Assemble Data

12172R-1.IR_full       1   CATTCTTCTTGGGGTGTGGATATCCGCTCCTGAAGGTCTGGGTAACACGATCAAGGATCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     1   CATTCTTCTTGGGGTGTGGATATCCGCTCCTGAAGGTCTGGGTAACACGATCAAGGATCG 60


12172R-1.IR_full       61  CAATCTCTTCGCCACCGAACTCTTCCAAACCCTCGCCACAGATCGCCAGGATGAGAACGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     61  CAATCTCTTCGCCACCGAACTCTTCCAAACCCTCGCCACAGATCGCCAGGATGAGAACGT 120


12172R-1.IR_full       121 GATCATCTCGCCGGTTTCCATCCAGCTGGCCCTCGGGTTGGCTTACTACGGAGCTGAGGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     121 GATCATCTCGCCGGTTTCCATCCAGCTGGCCCTCGGGTTGGCTTACTACGGAGCTGAGGG 180


12172R-1.IR_full       181 CAGGACGGCCGCGGAACTGCAGAAGACCTTGCACGCCTCCGCCAAGGAGAGCAAAGATGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     181 CAGGACGGCCGCGGAACTGCAGAAGACCTTGCACGCCTCCGCCAAGGAGAGCAAAGATGG 240


12172R-1.IR_full       241 TCTGGCCGAGAGCTACCACAACCTGCTGCACTCTTACATCAAGTCCAAGACCGTGTTGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     241 TCTGGCCGAGAGCTACCACAACCTGCTGCACTCTTACATCAAGTCCAAGACCGTGTTGGA 300


12172R-1.IR_full       301 GATCGCCAACAAGGTGTACACCCGGCAGAATCTCACGGTATCTAGCCACTTCCGAGAGGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     301 GATCGCCAACAAGGTGTACACCCGGCAGAATCTCACGGTATCTAGCCACTTCCGAGAGGT 360


12172R-1.IR_full       361 GGCCCAGAAGTACTTCGACTCCGAGGTAGAACCACTGGACTTCAGTCGCGAAACGGAGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     361 GGCCCAGAAGTACTTCGACTCCGAGGTAGAACCACTGGACTTCAGTCGCGAAACGGAGGC 420


12172R-1.IR_full       421 CGTGGAGCAGATCAACCGCTGGGTGAAGCAGCAGACGGAGAACAAGATCGAACGGGTGGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12172R-1.in silico     421 CGTGGAGCAGATCAACCGCTGGGTGAAGCAGCAGACGGAGAACAAGATCGAACGGGTGGT 480


12172R-1.IR_full       481 GGAAAGCCTGGAGCCGGACA 500
                           ||||||||||||||||||||
12172R-1.in silico     481 GGAAAGCCTGGAGCCGGACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080066.2  CG12172-RA (Spn43Aa), mRNA 
0   NM_078723.2  CG3022-RA, transcript variant A (GABA-B-R3), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_167722.1  CG10998-RB, transcript variant B (r-cup), mRNA 
0   NM_134575.2  CG10998-RA, transcript variant A (r-cup), mRNA 
0   NM_143767.2  CG11331-RA (Spn27A), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_141865.1  CG6959-RA, transcript variant A (CG6959), mRNA 
0   NM_206475.1  CG6959-RB, transcript variant B (CG6959), mRNA 
0   NM_139839.3  CG32381-RA (unc-13-4A), mRNA 
0   NM_144026.1  CG11458-RA (CG11458), mRNA 
0   NM_078510.2  CG4039-RA (Mcm6), mRNA 
0   NM_136455.1  CG2093-RA (CG2093), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_142636.1  CG5191-RB, transcript variant B (CG5191), mRNA 
0   NM_169904.1  CG5191-RA, transcript variant A (CG5191), mRNA 
0   NM_169902.1  CG5191-RC, transcript variant C (CG5191), mRNA 
0   NM_169905.1  CG5191-RD, transcript variant D (CG5191), mRNA 
0   NM_169903.1  CG5191-RE, transcript variant E (CG5191), mRNA 
0   NM_140058.2  CG3529-RB (CG3529), mRNA 
0   NM_167243.1  CG32675-RC, transcript variant C (Tango5), mRNA 
0   NM_167242.1  CG32675-RA, transcript variant A (Tango5), mRNA 
0   NM_167244.1  CG32675-RB, transcript variant B (Tango5), mRNA 
0   37  66  NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
0   NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.