National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12162R-3 
 Symbol CG12162  Full Name CG12162 
 CG No CG12162  Old CG No CG12162 
 Synonyms CG12162 
 Accession No (Link to NCBI) NM_141283.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGGTCACCTTTCTCGGCAAC 
 Primer Seq. 3'
aatctagaggtaccTGGCTGCTGTACTGAAAGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gCGGNTCACC TTTCTCGGCA ACCAGGACTC CAACCGCAGC CTCTACGCCA TCCCCGGGCT 
0061 GGACTACGTG GCGCCACGAG GACATCATGC CTTACAGCTC CAGCGATNAA GAGNCCGCTG 
0121 NAGCACGAGC TGTTCGATAA GTTCCTTACG CACGCTCCGG ACGCGGACCC GCCATTTGTG 
0181 GGCCAGGACA CTCTGAAGGC GTGGCAGGAA GAAGAACCAT CCCTGGCTGG ACATGAGCGA 
0241 TGTACACAAG GGAGACCACG GAGAACGTGC GCATTACCGT GATTCCCTTC TACATGGGTT 
0301 GCCGGGAGAC GCCTGCTAGT TCGGTCTACT GGTGGCGCTA CTGCATCCGA CTGGAGAACC 
0361 TCGGCGAGCT GAGCGTGCAG CTGCGcgaNC GCNANTGGCG CATTTTCTCA CTGTCTGGAA 
0421 CCCTGGAGAC GGTGCGCGGA AGAGGAGTGG TggGCCAGGA GCCCATTCTG AgNNCCNNGN 
0481 TGCCCGCCTT TCAGTACAGC AGCCA 
 in silico PCR Fragment
0001 GCGG-TCACC TTTCTCGGCA ACCAGGACTC CAACCGCAGC CTCTACGCCA TCCCCGGGCT 
0061 GGACTACGTG GC-CCACGAG GACATCATGC CTTACAGCTC CAGCGA-GAA GAGTCCGCTG 
0121 CAGCACGAGC TGTTCGATAA GTTCCTTACG CACGCTCCGG ACGCGGACCC GCCATTTGTG 
0181 GGCCAGGACA CTCTGAAGGC GTGGCAGG-A GAAGAACCAT CCCTGGCTGG ACATGAGCGA 
0241 TGTACACAA- GGAGACCACG GAGAACGTGC GCATTACCGT GATTCCCTTC TACATGGGTT 
0301 GCCGGGAGAC GCCTGCTAGT TCGGTCTACT GGTGGCGCTA CTGCATCCGA CTGGAGAACC 
0361 TCGGCGAGCT GAGCGTGCAG CTGCGCGAGC GCCACTGGCG CATTTTCTCA CTGTCTGGAA 
0421 CCCTGGAGAC GGTGCGCGGA AGAGGAGTGG TGGGCCAGGA GCCCATTCTG AGCCCCCGGC 
0481 TGCCCGCCTT TCAGTACAGC AGCCA 
 Assemble Data

12162R-3.IR_full       1   GCGGNTCACCTTTCTCGGCAACCAGGACTCCAACCGCAGCCTCTACGCCATCCCCGGGCT 60
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
12162R-3.in silico     1   GCGG-TCACCTTTCTCGGCAACCAGGACTCCAACCGCAGCCTCTACGCCATCCCCGGGCT 60


12162R-3.IR_full       61  GGACTACGTGGCGCCACGAGGACATCATGCCTTACAGCTCCAGCGATNAAGAGNCCGCTG 120
                           |||||||||||| |||||||||||||||||||||||||||||||||  ||||| ||||||
12162R-3.in silico     61  GGACTACGTGGC-CCACGAGGACATCATGCCTTACAGCTCCAGCGA-GAAGAGTCCGCTG 120


12162R-3.IR_full        121 AGCACGAGCTGTTCGATAAGTTCCTTACGCACGCTCCGGACGCGGACCCGCCATTTGTG 179
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12162R-3.in silico      121 AGCACGAGCTGTTCGATAAGTTCCTTACGCACGCTCCGGACGCGGACCCGCCATTTGTG 179


12162R-3.IR_full       181 GGCCAGGACACTCTGAAGGCGTGGCAGGAAGAAGAACCATCCCTGGCTGGACATGAGCGA 239
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
12162R-3.in silico     181 GGCCAGGACACTCTGAAGGCGTGGCAGG-AGAAGAACCATCCCTGGCTGGACATGAGCGA 239


12162R-3.IR_full       241 TGTACACAAGGGAGACCACGGAGAACGTGCGCATTACCGTGATTCCCTTCTACATGGGTT 299
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
12162R-3.in silico     241 TGTACACAA-GGAGACCACGGAGAACGTGCGCATTACCGTGATTCCCTTCTACATGGGTT 299


12162R-3.IR_full       301 GCCGGGAGACGCCTGCTAGTTCGGTCTACTGGTGGCGCTACTGCATCCGACTGGAGAACC 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12162R-3.in silico     301 GCCGGGAGACGCCTGCTAGTTCGGTCTACTGGTGGCGCTACTGCATCCGACTGGAGAACC 359


12162R-3.IR_full       361 TCGGCGAGCTGAGCGTGCAGCTGCGCGANCGCNANTGGCGCATTTTCTCACTGTCTGGAA 419
                           |||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||
12162R-3.in silico     361 TCGGCGAGCTGAGCGTGCAGCTGCGCGAGCGCCACTGGCGCATTTTCTCACTGTCTGGAA 419


12162R-3.IR_full       421 CCCTGGAGACGGTGCGCGGAAGAGGAGTGGTGGGCCAGGAGCCCATTCTGAGNNCCNNGN 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||  | 
12162R-3.in silico     421 CCCTGGAGACGGTGCGCGGAAGAGGAGTGGTGGGCCAGGAGCCCATTCTGAGCCCCCGGC 479


12162R-3.IR_full       481 TGCCCGCCTTTCAGTACAGCAGCCA 504
                           |||||||||||||||||||||||||
12162R-3.in silico     481 TGCCCGCCTTTCAGTACAGCAGCCA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141283.2  CG12162-RA, transcript variant A (CG12162), mRNA 
100   482  NM_169054.1  CG12162-RB, transcript variant B (CG12162), mRNA 
0   NM_132683.1  CG12177-RA (CG12177), mRNA 
0   NM_206528.1  CG5670-RE, transcript variant E (Atpalpha), mRNA 
0   NM_169937.1  CG5670-RB, transcript variant B (Atpalpha), mRNA 
0   NM_206525.1  CG5670-RH, transcript variant H (Atpalpha), mRNA 
0   NM_169939.1  CG5670-RD, transcript variant D (Atpalpha), mRNA 
0   NM_079000.2  CG3879-RA (Mdr49), mRNA 
0   14  NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   10  NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_078601.2  CG9533-RA (rut), mRNA 
0   NM_165110.1  CG11861-RB, transcript variant B (gft), mRNA 
0   NM_142133.2  CG14855-RA (CG14855), mRNA 
0   NM_140022.1  CG5087-RA (CG5087), mRNA 
0   NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_166658.1  CG3209-RB, transcript variant B (CG3209), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_057591.3  CG7562-RA (Trf), mRNA 
0   NM_167288.1  CG32666-RB, transcript variant B (CG32666), mRNA 
0   NM_206688.1  CG32666-RA, transcript variant A (CG32666), mRNA 
0   NM_139379.2  CG13929-RB, transcript variant B (metl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.