National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12162R-1 
 Symbol CG12162  Full Name CG12162 
 CG No CG12162  Old CG No CG12162 
 Synonyms CG12162 
 Accession No (Link to NCBI) NM_141283.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCGG-TCACCTTTCTCGGCAACCAGGACTCCAACCGCAGCCTCTACGCCATCCCCGGGCT 60

                           |||||||||||| |||||||||||||||||||||||||||||||||  ||||| |||||| silico     61  GGACTACGTGGC-CCACGAGGACATCATGCCTTACAGCTCCAGCGA-GAAGAGTCCGCTG 120

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      121 AGCACGAGCTGTTCGATAAGTTCCTTACGCACGCTCCGGACGCGGACCCGCCATTTGTG 179

                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     181 GGCCAGGACACTCTGAAGGCGTGGCAGG-AGAAGAACCATCCCTGGCTGGACATGAGCGA 239

                           ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGTACACAA-GGAGACCACGGAGAACGTGCGCATTACCGTGATTCCCTTCTACATGGGTT 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCGGGAGACGCCTGCTAGTTCGGTCTACTGGTGGCGCTACTGCATCCGACTGGAGAACC 359

                           |||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| silico     361 TCGGCGAGCTGAGCGTGCAGCTGCGCGAGCGCCACTGGCGCATTTTCTCACTGTCTGGAA 419

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||  | silico     421 CCCTGGAGACGGTGCGCGGAAGAGGAGTGGTGGGCCAGGAGCCCATTCTGAGCCCCCGGC 479

12162R-1.IR_full       481 TGCCCGCCTTTCAGTACAGCAGCCA 504
                           ||||||||||||||||||||||||| silico     481 TGCCCGCCTTTCAGTACAGCAGCCA 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141283.2  CG12162-RA, transcript variant A (CG12162), mRNA 
100   482  NM_169054.1  CG12162-RB, transcript variant B (CG12162), mRNA 
0   NM_132683.1  CG12177-RA (CG12177), mRNA 
0   NM_206528.1  CG5670-RE, transcript variant E (Atpalpha), mRNA 
0   NM_169937.1  CG5670-RB, transcript variant B (Atpalpha), mRNA 
0   NM_206525.1  CG5670-RH, transcript variant H (Atpalpha), mRNA 
0   NM_169939.1  CG5670-RD, transcript variant D (Atpalpha), mRNA 
0   NM_079000.2  CG3879-RA (Mdr49), mRNA 
0   14  NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   10  NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_078601.2  CG9533-RA (rut), mRNA 
0   NM_165110.1  CG11861-RB, transcript variant B (gft), mRNA 
0   NM_142133.2  CG14855-RA (CG14855), mRNA 
0   NM_140022.1  CG5087-RA (CG5087), mRNA 
0   NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_166658.1  CG3209-RB, transcript variant B (CG3209), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_057591.3  CG7562-RA (Trf), mRNA 
0   NM_167288.1  CG32666-RB, transcript variant B (CG32666), mRNA 
0   NM_206688.1  CG32666-RA, transcript variant A (CG32666), mRNA 
0   NM_139379.2  CG13929-RB, transcript variant B (metl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.