National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12109R-4 
 Symbol Caf1-180  Full Name Caf1-180 
 CG No CG12109  Old CG No CG12109 
 Synonyms NURF, p180, CG12109, Caf1-180 
 Accession No (Link to NCBI) NM_132267.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCACGCTGGCGTTGTTAAG 
 Primer Seq. 3'
aatctagaggtaccGACTTCTTGGGCTTCAACTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCACGCTG GCGTTGTTAA GACGNCGCTC AGCGGCAGGA AAAAAGAATG CGGCTGTGCC 
0061 GGCCAAATCA GCGGAAAAGA CGGCCAGCGG TGGCAAGAAG TTCGTGCAGA CGCGTTTGCC 
0121 CTTTAAGTTA TTAACGCCAG GCGGTGGGGC GGTGCCCACA TCCTCCTCCT CCTCATCGTC 
0181 CCCCCGCCAC TATCGGCTCT GGCCCCGTCA CTGTAATCCT GGATGAGGAC GATCCCGCTC 
0241 CGCGCAAGCG AAAACTTTCG TACGACGATG AGTCGCCATC GGAGGGCACT GGCTGCTCTA 
0301 CGGGGCAACT GCGACGTTCG ACCAGCAAGG AGAATCTGGA TCTGGCCAGT TCCATAGCCA 
0361 CTAAAAAGGT CAAGACCACG GATTCGGTAG TGGAAGATGT CATAGAACTG GATGAGGACG 
0421 AGGCCGACAA GGAGATAGAG GACCAGGATC AGTTGGTAGA GGCCAAGTCC TCCAAGGAGG 
0481 TCAAGTTGAA GCCCAAGAAG TC 
 in silico PCR Fragment
0001 ATGCACGCTG GCGTTGTTAA GACGCCGCTC AGCGGCAGGA AAAAAG-ATG CGGCTGTGCC 
0061 GGCCAAATCA GCGGAAAAGA CGGCCAGCGG TGGCAAGAAG TTCGTGCAGA CGCGTTTGCC 
0121 CTTTAAGTTA TTAACGCCAG GCGGTGGGGC GGTGCCCACA TCCTCCTCCT CCTCATCGT- 
0181 CCCCCGCCAC TATCGGCTCT GGCCCCGTCA CTGTAATCCT GGATGAGGAC GATCCCGCTC 
0241 CGCGCAAGCG AAAACTTTCG TACGACGATG AGTCGCCATC GGAGGGCACT GGCTGCTCTA 
0301 CGGGGCAACT GCGACGTTCG ACCAGCAAGG AGAATCTGGA TCTGGCCAGT TCCATAGCCA 
0361 CTAAAAAGGT CAAGACCACG GATTCGGTAG TGGAAGATGT CATAGAACTG GATGAGGACG 
0421 AGGCCGACAA GGAGATAGAG GACCAGGATC AGTTGGTAGA GGCCAAGTCC TCCAAGGAGG 
0481 TCAAGTTGAA GCCCAAGAAG TC 
 Assemble Data

12109R-4.IR_full       1   ATGCACGCTGGCGTTGTTAAGACGNCGCTCAGCGGCAGGAAAAAAGAATGCGGCTGTGCC 60
                           |||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||
12109R-4.in silico     1   ATGCACGCTGGCGTTGTTAAGACGCCGCTCAGCGGCAGGAAAAAAG-ATGCGGCTGTGCC 60


12109R-4.IR_full       61  GGCCAAATCAGCGGAAAAGACGGCCAGCGGTGGCAAGAAGTTCGTGCAGACGCGTTTGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12109R-4.in silico     61  GGCCAAATCAGCGGAAAAGACGGCCAGCGGTGGCAAGAAGTTCGTGCAGACGCGTTTGCC 120


12109R-4.IR_full       121 CTTTAAGTTATTAACGCCAGGCGGTGGGGCGGTGCCCACATCCTCCTCCTCCTCATCGTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
12109R-4.in silico     121 CTTTAAGTTATTAACGCCAGGCGGTGGGGCGGTGCCCACATCCTCCTCCTCCTCATCGT- 180


12109R-4.IR_full       181 CCCCCGCCACTATCGGCTCTGGCCCCGTCACTGTAATCCTGGATGAGGACGATCCCGCTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12109R-4.in silico     181 CCCCCGCCACTATCGGCTCTGGCCCCGTCACTGTAATCCTGGATGAGGACGATCCCGCTC 240


12109R-4.IR_full       241 CGCGCAAGCGAAAACTTTCGTACGACGATGAGTCGCCATCGGAGGGCACTGGCTGCTCTA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12109R-4.in silico     241 CGCGCAAGCGAAAACTTTCGTACGACGATGAGTCGCCATCGGAGGGCACTGGCTGCTCTA 300


12109R-4.IR_full       301 CGGGGCAACTGCGACGTTCGACCAGCAAGGAGAATCTGGATCTGGCCAGTTCCATAGCCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12109R-4.in silico     301 CGGGGCAACTGCGACGTTCGACCAGCAAGGAGAATCTGGATCTGGCCAGTTCCATAGCCA 360


12109R-4.IR_full       361 CTAAAAAGGTCAAGACCACGGATTCGGTAGTGGAAGATGTCATAGAACTGGATGAGGACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12109R-4.in silico     361 CTAAAAAGGTCAAGACCACGGATTCGGTAGTGGAAGATGTCATAGAACTGGATGAGGACG 420


12109R-4.IR_full       421 AGGCCGACAAGGAGATAGAGGACCAGGATCAGTTGGTAGAGGCCAAGTCCTCCAAGGAGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12109R-4.in silico     421 AGGCCGACAAGGAGATAGAGGACCAGGATCAGTTGGTAGAGGCCAAGTCCTCCAAGGAGG 480


12109R-4.IR_full       481 TCAAGTTGAAGCCCAAGAAGTC 502
                           ||||||||||||||||||||||
12109R-4.in silico     481 TCAAGTTGAAGCCCAAGAAGTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  21  NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0.62   14  42  NM_058003.3  CG5216-RA (Sir2), mRNA 
0.41   10  NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0.41   NM_137751.3  CG10082-RB, transcript variant B (CG10082), mRNA 
0.2   21  NM_080320.2  CG3653-RB, transcript variant B (kirre), mRNA 
0.2   21  NM_166958.1  CG3653-RA, transcript variant A (kirre), mRNA 
0.2   20  NM_130585.2  CG14810-RA (CG14810), mRNA 
0.2   NM_136202.4  CG31678-RA (CG31678), mRNA 
0.2   NM_139967.1  CG7037-RB, transcript variant B (Cbl), mRNA 
0   13  NM_139804.1  CG14821-RA (CG14821), mRNA 
0   14  NM_135388.2  CG9233-RA (fu2), mRNA 
0   17  NM_132280.3  CG10648-RA (CG10648), mRNA 
0   18  67  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   16  45  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   13  20  NM_137951.1  CG5357-RA (CG5357), mRNA 
0   50  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   50  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   17  NM_137047.2  CG6197-RA (CG6197), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   23  46  NM_167309.1  CG32663-RA (CG32663), mRNA 
0   21  109  NM_001014737.1  CG7107-RG, transcript variant G (up), mRNA 
0   21  109  NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 
0   21  109  NM_167375.1  CG7107-RB, transcript variant B (up), mRNA 
0   21  109  NM_001014738.1  CG7107-RF, transcript variant F (up), mRNA 
0   21  109  NM_167376.1  CG7107-RD, transcript variant D (up), mRNA 
0   20  106  NM_001014739.1  CG7107-RE, transcript variant E (up), mRNA 
0   18  62  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   18  62  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   14  83  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   13  70  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.