National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12109R-2 
 Symbol Caf1-180  Full Name Caf1-180 
 CG No CG12109  Old CG No CG12109 
 Synonyms NURF, p180, CG12109, Caf1-180 
 Accession No (Link to NCBI) NM_132267.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| silico     1   ATGCACGCTGGCGTTGTTAAGACGCCGCTCAGCGGCAGGAAAAAAG-ATGCGGCTGTGCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGCCAAATCAGCGGAAAAGACGGCCAGCGGTGGCAAGAAGTTCGTGCAGACGCGTTTGCC 120

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTTTAAGTTATTAACGCCAGGCGGTGGGGCGGTGCCCACATCCTCCTCCTCCTCATCGT- 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCCCGCCACTATCGGCTCTGGCCCCGTCACTGTAATCCTGGATGAGGACGATCCCGCTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCGCAAGCGAAAACTTTCGTACGACGATGAGTCGCCATCGGAGGGCACTGGCTGCTCTA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGGGCAACTGCGACGTTCGACCAGCAAGGAGAATCTGGATCTGGCCAGTTCCATAGCCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTAAAAAGGTCAAGACCACGGATTCGGTAGTGGAAGATGTCATAGAACTGGATGAGGACG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGCCGACAAGGAGATAGAGGACCAGGATCAGTTGGTAGAGGCCAAGTCCTCCAAGGAGG 480

12109R-2.IR_full       481 TCAAGTTGAAGCCCAAGAAGTC 502
                           |||||||||||||||||||||| silico     481 TCAAGTTGAAGCCCAAGAAGTC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  21  NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0.62   14  42  NM_058003.3  CG5216-RA (Sir2), mRNA 
0.41   10  NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0.41   NM_137751.3  CG10082-RB, transcript variant B (CG10082), mRNA 
0.2   21  NM_080320.2  CG3653-RB, transcript variant B (kirre), mRNA 
0.2   21  NM_166958.1  CG3653-RA, transcript variant A (kirre), mRNA 
0.2   20  NM_130585.2  CG14810-RA (CG14810), mRNA 
0.2   NM_136202.4  CG31678-RA (CG31678), mRNA 
0.2   NM_139967.1  CG7037-RB, transcript variant B (Cbl), mRNA 
0   13  NM_139804.1  CG14821-RA (CG14821), mRNA 
0   14  NM_135388.2  CG9233-RA (fu2), mRNA 
0   17  NM_132280.3  CG10648-RA (CG10648), mRNA 
0   18  67  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   16  45  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   13  20  NM_137951.1  CG5357-RA (CG5357), mRNA 
0   50  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   50  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   17  NM_137047.2  CG6197-RA (CG6197), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   23  46  NM_167309.1  CG32663-RA (CG32663), mRNA 
0   21  109  NM_001014737.1  CG7107-RG, transcript variant G (up), mRNA 
0   21  109  NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 
0   21  109  NM_167375.1  CG7107-RB, transcript variant B (up), mRNA 
0   21  109  NM_001014738.1  CG7107-RF, transcript variant F (up), mRNA 
0   21  109  NM_167376.1  CG7107-RD, transcript variant D (up), mRNA 
0   20  106  NM_001014739.1  CG7107-RE, transcript variant E (up), mRNA 
0   18  62  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   18  62  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   14  83  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   13  70  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.