National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12093R-3 
 Symbol CG12093  Full Name CG12093 
 CG No CG12093  Old CG No CG12093 
 Synonyms CG12093 
 Accession No (Link to NCBI) NM_139490.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCATTACTTGACCCTCTTGT 
 Primer Seq. 3'
aatctagaggtaccTGCTCTTGCCATCATCACAGC 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 GGCANTTACT TGACCCTCTT GTGCCTTGGG TTCGCCCTCA TCGATGCGAA ATCCATCAAG 
0061 AAGTCGCAGG CCAATCTGTT GGAGCCAACT CTTGATCCTG ATGAGAAGCT AGGGAAGATT 
0121 GGGAAGTCCC CACCCGACAT TTCCAATGAT GTGCAACGTG TGCAGGTTCC ATTAGGTGCG 
0181 ACGCCCGGCA AGAATGGCTG GCAGGGCAAG TGGTTTCCCC ATGCCCCTGG ACAACAGCAG 
0241 GAAGCGATTG AATTAAAAAT GAAGAGCACC ACGGAGGAAG TTCCTCCGCT GGAGTTCACA 
0301 ACCAAGGATG GCTGGCAGGG CAAGTGGTTT CCACAAGCTC CCGGAGAGCC GCACTTGGTG 
0361 AAGAAAAAAC CGCTGGTCGA TAACAAAACC AAGTCGGGGG AAGTCCACCA CACAGGATAC 
0421 TTGGCAGGGT AAATTGTTTC CGCAGGGTCC CAATGAATCG CACAAGACTA AACAAAGCAG 
0481 CTGTGATGAT GGCAAGAGCA  
 in silico PCR Fragment
0001 GGCA-TTACT TGACCCTCTT GTGCCTTGGG TTCGCCCTCA TCGATGCGAA ATCCATCAAG 
0061 AAGTCGCAGG CCAATCTGTT GGAGCCAACT CTTGATCCTG ATGAGAAGCT AGGGAAGATT 
0121 GGGAAGTCCC CACCCGACAT TTCCAATGAT GTGCAACGTG TGCAGGTTCC ATTAGGTGCG 
0181 ACGCCCGGCA AGAATGGCTG GCAGGGCAAG TGGTTTCCCC ATGCCCCTGG ACAACAGCAG 
0241 GAAGCGATTG AATTAAAAAT GAAGAGCACC ACGGAGGAAG TTCCTCCGCT GGAGTTCACA 
0301 ACCAAGGATG GCTGGCAGGG CAAGTGGTTT CCACAAGCTC CCGGAGAGCC GCACTTGGTG 
0361 AAGAAAAAAC CGCTGGTCGA TAACAAAACC AAGTC-GGGG AAGTCCACCA CACAGGATAC 
0421 TTGGCAGGGT AAATTGTTTC CGCAGGGTCC CAATGAATCG CACAAGACTA AACAAAGCAG 
0481 CTGTGATGAT GGCAAGAGCA  
 Assemble Data

12093R-3.IR_full       1   GGCANTTACTTGACCCTCTTGTGCCTTGGGTTCGCCCTCATCGATGCGAAATCCATCAAG 60
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
12093R-3.in silico     1   GGCA-TTACTTGACCCTCTTGTGCCTTGGGTTCGCCCTCATCGATGCGAAATCCATCAAG 60


12093R-3.IR_full       61  AAGTCGCAGGCCAATCTGTTGGAGCCAACTCTTGATCCTGATGAGAAGCTAGGGAAGATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12093R-3.in silico     61  AAGTCGCAGGCCAATCTGTTGGAGCCAACTCTTGATCCTGATGAGAAGCTAGGGAAGATT 120


12093R-3.IR_full       121 GGGAAGTCCCCACCCGACATTTCCAATGATGTGCAACGTGTGCAGGTTCCATTAGGTGCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12093R-3.in silico     121 GGGAAGTCCCCACCCGACATTTCCAATGATGTGCAACGTGTGCAGGTTCCATTAGGTGCG 180


12093R-3.IR_full       181 ACGCCCGGCAAGAATGGCTGGCAGGGCAAGTGGTTTCCCCATGCCCCTGGACAACAGCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12093R-3.in silico     181 ACGCCCGGCAAGAATGGCTGGCAGGGCAAGTGGTTTCCCCATGCCCCTGGACAACAGCAG 240


12093R-3.IR_full       241 GAAGCGATTGAATTAAAAATGAAGAGCACCACGGAGGAAGTTCCTCCGCTGGAGTTCACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12093R-3.in silico     241 GAAGCGATTGAATTAAAAATGAAGAGCACCACGGAGGAAGTTCCTCCGCTGGAGTTCACA 300


12093R-3.IR_full       301 ACCAAGGATGGCTGGCAGGGCAAGTGGTTTCCACAAGCTCCCGGAGAGCCGCACTTGGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12093R-3.in silico     301 ACCAAGGATGGCTGGCAGGGCAAGTGGTTTCCACAAGCTCCCGGAGAGCCGCACTTGGTG 360


12093R-3.IR_full       361 AAGAAAAAACCGCTGGTCGATAACAAAACCAAGTCGGGGGAAGTCCACCACACAGGATAC 420
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
12093R-3.in silico     361 AAGAAAAAACCGCTGGTCGATAACAAAACCAAGTC-GGGGAAGTCCACCACACAGGATAC 420


12093R-3.IR_full       421 TTGGCAGGGTAAATTGTTTCCGCAGGGTCCCAATGAATCGCACAAGACTAAACAAAGCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12093R-3.in silico     421 TTGGCAGGGTAAATTGTTTCCGCAGGGTCCCAATGAATCGCACAAGACTAAACAAAGCAG 480


12093R-3.IR_full       481 CTGTGATGATGGCAAGAGCA 500
                           ||||||||||||||||||||
12093R-3.in silico     481 CTGTGATGATGGCAAGAGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
102.91  494  16  21  NM_139490.1  CG12093-RA (CG12093), mRNA 
0   NM_164401.3  CG31795-RB, transcript variant B (ia2), mRNA 
0   NM_134718.4  CG31795-RA, transcript variant A (ia2), mRNA 
0   NM_057277.2  CG8694-RA (LvpD), mRNA 
0   NM_135031.3  CG12787-RA, transcript variant A (hoe1), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_133081.1  CG15047-RA (CG15047), mRNA 
0   NM_142597.2  CG12254-RA (MED25), mRNA 
0   10  NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   10  NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_133005.2  CG12990-RA (CG12990), mRNA 
0   13  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_205923.1  CG7231-RC, transcript variant C (CG7231), mRNA 
0   NM_142306.3  CG10345-RA (CG10345), mRNA 
0   NM_142600.2  CG4433-RA, transcript variant A (CG4433), mRNA 
0   NM_206519.1  CG4433-RB, transcript variant B (CG4433), mRNA 
0   NM_206420.1  CG33291-RA (CG33291), mRNA 
0   NM_165943.1  CG8772-RB, transcript variant B (nemy), mRNA 
0   NM_136965.3  CG8772-RF, transcript variant F (nemy), mRNA 
0   NM_165938.1  CG8772-RA, transcript variant A (nemy), mRNA 
0   NM_143530.2  CG2217-RA (CG2217), mRNA 
0   NM_165942.1  CG8772-RC, transcript variant C (nemy), mRNA 
0   NM_165941.1  CG8772-RE, transcript variant E (nemy), mRNA 
0   NM_165939.1  CG8772-RD, transcript variant D (nemy), mRNA 
0   NM_206381.1  CG16838-RC, transcript variant C (CG16838), mRNA 
0   NM_166580.1  CG32834-RA (CG32834), mRNA 
0   NM_206380.1  CG16838-RD, transcript variant D (CG16838), mRNA 
0   NM_176593.1  CG1447-RB, transcript variant B (Ptx1), mRNA 
0   NM_170531.3  CG1447-RA, transcript variant A (Ptx1), mRNA 
0   NM_135910.1  CG15256-RA (CG15256), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.