National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12082R-2 
 Symbol CG12082  Full Name CG12082 
 CG No CG12082  Old CG No CG12082 
 Synonyms CG12082 
 Accession No (Link to NCBI) NM_139516.1 
 Inserted Chr. ll 
 Insertional Mutation  mosaic eye color 
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kovács L, Nagy O, Pál M, Udvardy A, Popescu O, Deák P.
Role of the deubiquitylating enzyme DmUsp5 in coupling ubiquitin equilibrium to development and apoptosis in Drosophila melanogaster.
PLoS ONE (2015) 10(3) e0120875 [ PubMed ID = 25806519 ] [ RRC reference ]

Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) [ PubMed ID = 30333215 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Zhang J, Liu M, Su Y, Du J, Zhu AJ.
A targeted in vivo RNAi screen reveals deubiquitinases as new regulators of Notch signaling.
G3 (Bethesda) (2012) 2(12) 1563-75 [ PubMed ID = 23275879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGAGTGCGTCTACTCCTAT 
 Primer Seq. 3'
aatctagaggtaccTTATCCAGCTGCTGCAGGTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NACGAGTGCG TCTACTCCTA TGACAATCCC GAGACGCCCA CCGGTTTGTA CGTGTGCCTG 
0061 CACAGCTTTT TGGGCTTCGG CGAGGCGTAT GTGCGGGAGT ATGCCGACAA GACCGGCAAC 
0121 CGGGTCTTCC TCCACATCCA GCGGGTGAAG ACGATCAAGG AGGGCGCCGA CATGGAGGCC 
0181 GAATGCGCGG AGTCGGAGGC AGGACCGGAA CGGAAGATCA CCCGCCTGGC CATTGGCGTC 
0241 GAGGGCGGCT ACAACGAGTC GGACATGGCC AAGAAGTACG AGATCAAGGA CACGTACAGC 
0301 ATCGTGGTGG CTCCGCACCT GGATAAGAAG CTGCCCTATC CGGATCCAGA GCTGCCCATG 
0361 CGTGTCACCC AGTCGGTGGA AGCGATCCTG GCCGCCGATT CGGCAATTGC CAAGTTGGAG 
0421 AAGGCCACGC TGATGGGCAC CTGGGATGGT GAAGTGCGTC AGGCGTCGAA GTACGCAGAT 
0481 AACCTGCAGC AGCTGGATAA  
 in silico PCR Fragment
0001 GACGAGTGCG TCTACTCCTA TGACAATCCC GAGACGCCCA CCGGTTTGTA CGTGTGCCTG 
0061 CACAGCTTTT TGGGCTTCGG CGAGGCGTAT GTGCGGGAGT ATGCCGACAA GACCGGCAAC 
0121 CGGGTCTTCC TCCACATCCA GCGGGTGAAG ACGATCAAGG AGGGCGCCGA CATGGAGGCC 
0181 GAATGCGCGG AGTCGGAGGC AGGACCGGAA CGGAAGATCA CCCGCCTGGC CATTGGCGTC 
0241 GAGGGCGGCT ACAACGAGTC GGACATGGCC AAGAAGTACG AGATCAAGGA CACGTACAGC 
0301 ATCGTGGTGG CTCCGCACCT GGATAAGAAG CTGCCCTATC CGGATCCAGA GCTGCCCATG 
0361 CGTGTCACCC AGTCGGTGGA AGCGATCCTG GCCGCCGACT CGGCAATTGC CAAGTTGGAG 
0421 AAGGCCACGC TGATGGGCAC CTGGGATGGT GAAGTGCGTC AGGCGTCGAA GTACGCAGAT 
0481 AACCTGCAGC AGCTGGATAA  
 Assemble Data

12082R-2.IR_full        1   ACGAGTGCGTCTACTCCTATGACAATCCCGAGACGCCCACCGGTTTGTACGTGTGCCTG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12082R-2.in silico      1   ACGAGTGCGTCTACTCCTATGACAATCCCGAGACGCCCACCGGTTTGTACGTGTGCCTG 59


12082R-2.IR_full       61  CACAGCTTTTTGGGCTTCGGCGAGGCGTATGTGCGGGAGTATGCCGACAAGACCGGCAAC 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12082R-2.in silico     61  CACAGCTTTTTGGGCTTCGGCGAGGCGTATGTGCGGGAGTATGCCGACAAGACCGGCAAC 119


12082R-2.IR_full       121 CGGGTCTTCCTCCACATCCAGCGGGTGAAGACGATCAAGGAGGGCGCCGACATGGAGGCC 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12082R-2.in silico     121 CGGGTCTTCCTCCACATCCAGCGGGTGAAGACGATCAAGGAGGGCGCCGACATGGAGGCC 179


12082R-2.IR_full       181 GAATGCGCGGAGTCGGAGGCAGGACCGGAACGGAAGATCACCCGCCTGGCCATTGGCGTC 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12082R-2.in silico     181 GAATGCGCGGAGTCGGAGGCAGGACCGGAACGGAAGATCACCCGCCTGGCCATTGGCGTC 239


12082R-2.IR_full       241 GAGGGCGGCTACAACGAGTCGGACATGGCCAAGAAGTACGAGATCAAGGACACGTACAGC 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12082R-2.in silico     241 GAGGGCGGCTACAACGAGTCGGACATGGCCAAGAAGTACGAGATCAAGGACACGTACAGC 299


12082R-2.IR_full       301 ATCGTGGTGGCTCCGCACCTGGATAAGAAGCTGCCCTATCCGGATCCAGAGCTGCCCATG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12082R-2.in silico     301 ATCGTGGTGGCTCCGCACCTGGATAAGAAGCTGCCCTATCCGGATCCAGAGCTGCCCATG 359


12082R-2.IR_full       361 CGTGTCACCCAGTCGGTGGAAGCGATCCTGGCCGCCGATTCGGCAATTGCCAAGTTGGAG 419
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
12082R-2.in silico     361 CGTGTCACCCAGTCGGTGGAAGCGATCCTGGCCGCCGACTCGGCAATTGCCAAGTTGGAG 419


12082R-2.IR_full       421 AAGGCCACGCTGATGGGCACCTGGGATGGTGAAGTGCGTCAGGCGTCGAAGTACGCAGAT 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12082R-2.in silico     421 AAGGCCACGCTGATGGGCACCTGGGATGGTGAAGTGCGTCAGGCGTCGAAGTACGCAGAT 479


12082R-2.IR_full       481 AACCTGCAGCAGCTGGATAA 499
                           ||||||||||||||||||||
12082R-2.in silico     481 AACCTGCAGCAGCTGGATAA 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139516.1  CG12082-RA (CG12082), mRNA 
0   NM_135667.3  CG6614-RA (CG6614), mRNA 
0   NM_057414.3  CG1389-RA (tor), mRNA 
0   NM_132740.1  CG15890-RA (CG15890), mRNA 
0   NM_206483.1  CG15890-RA (CG15890), mRNA, sub-group O CG3143-RB, transcript variant B (foxo), mRNA 
0   NM_206482.1  CG15890-RA (CG15890), mRNA, sub-group O CG3143-RB, transcript variant B (foxo), mRNA, sub-group O CG3143-RC, transcript variant C (foxo), mRNA 
0   NM_142073.3  CG15890-RA (CG15890), mRNA, sub-group O CG3143-RB, transcript variant B (foxo), mRNA, sub-group O CG3143-RC, transcript variant C (foxo), mRNA, sub-group O CG3143-RA, transcript variant A (foxo), mRNA 
0   NM_136876.2  CG8321-RA (CG8321), mRNA 
0   NM_205985.1  CG32975-RC, transcript variant C (nAcRalpha-34E), mRNA 
0   NM_205986.1  CG32975-RB, transcript variant B (nAcRalpha-34E), mRNA 
0   NM_176035.2  CG32975-RA, transcript variant A (nAcRalpha-34E), mRNA 
0   NM_169264.1  CG9735-RA, transcript variant A (Aats-trp), mRNA 
0   NM_057303.4  CG7831-RA (ncd), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_132090.2  CG3446-RA (CG3446), mRNA 
0   NM_206558.1  CG33340-RA (CG33340), mRNA 
0   NM_140571.3  CG5895-RA (CG5895), mRNA 
0   NM_057977.3  CG9239-RA, transcript variant A (B4), mRNA 
0   NM_165046.1  CG9239-RB, transcript variant B (B4), mRNA 
0   NM_132328.1  CG17446-RA (CG17446), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_206381.1  CG16838-RC, transcript variant C (CG16838), mRNA 
0   NM_206380.1  CG16838-RD, transcript variant D (CG16838), mRNA 
0   NM_136672.2  CG1688-RA (CG1688), mRNA 
0   NM_141308.1  CG12170-RA (CG12170), mRNA 
0   NM_132199.2  CG2206-RA, transcript variant A (l(1)G0193), mRNA 
0   11  NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_170004.1  CG7070-RB, transcript variant B (PyK), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.