National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12030R-2 
 Symbol CG12030  Full Name CG12030 
 CG No CG12030  Old CG No CG12030 
 Synonyms CG12030 
 Accession No (Link to NCBI) NM_138200.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Daenzer JM, Sanders RD, Hang D, Fridovich-Keil JL.
UDP-galactose 4'-epimerase activities toward UDP-Gal and UDP-GalNAc play different roles in the development of Drosophila melanogaster.
PLoS Genet. (2012) 8(5) e1002721 [ PubMed ID = 22654673 ] [ RRC reference ]

Sanders RD, Sefton JM, Moberg KH, Fridovich-Keil JL.
UDP-galactose 4' epimerase (GALE) is essential for development of Drosophila melanogaster.
Dis Model Mech (2010) 3(9-10) 628-38 [ PubMed ID = 20519568 ] [ RRC reference ]

Mondal BC, Shim J, Evans CJ, Banerjee U.
Pvr expression regulators in equilibrium signal control and maintenance of Drosophila blood progenitors.
Elife (2014) 3 e03626 [ PubMed ID = 25201876 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCACACGGTTCTGGAGATGCT 
 Primer Seq. 3'
aatctagaggtaccGCGAAACCACTGCCCAACGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCACACGGTT CTGGAGATGC TCAATGCGGG CTACAACGTC ATCTGCGTGG ACAACCTGTG 
0061 CAACGCCTAC AGCAGCGGGG CCAAATTGCC GGAGGCCCTC AGCCGGGTGC AGGAAATCAC 
0121 CGGCAAGAAG GTCAACTTCT ATAGAGTGGA CATCACGGAC AGGGAGCAGG TGCGCTCCGT 
0181 CTTCCAGGAG CACAAAATCG ACATGGTGGC CCACTTTGCC GCCCTGAAGG CCGTGGGTGA 
0241 GTCCTGCCGC ATACCTTTGC AATACTACCA CAACAACATG ACCGGCACCA ATGTCCTGCT 
0301 GGAGGTGATG GCCGACAACA ATGTCTTCAA GTTCGTGTAC AGCTCCAGTG CCACCGTCTA 
0361 CGGTGAGCCA AAGTTCCTGC CCCGTGACCG AGGAGCATCC CCACGGGCAA ACTGTACATT 
0421 CGCCCCTACG GCAAGACTAA ATATTTCACC GAGGAGATTC CTCAAGGGAT CTGTGCCAAG 
0481 TCTGACAAGC GTTGGGCAGT GGTTTBGC 
 in silico PCR Fragment
0001 CCACACGGTT CTGGAGATGC TCAATGCGGG CTACAACGTC ATCTGCGTGG ACAACCTGTG 
0061 CAACGCCTAC AGCAGCGGGG CCAAACTGCC GGAGGCCCTC AGCCGGGTGC AGGAAATCAC 
0121 CGGCAAGAAG GTCAACTTCT ATAGAGTGGA CATCACGGAC AGGGAGCAGG TGCGCTCCGT 
0181 CTTCCAGGAG CACAAAATCG ACATGGTGGC CCACTTTGCC GCCCTGAAGG CCGTGGGTGA 
0241 GTCCTGCCGC ATACCTTTGC AGTACTACCA CAACAACATG ACCGGCACCA ATGTCCTGCT 
0301 GGAGGCGATG GCCGACAACA ATGTCTTCAA GTTCGTGTAC AGCTCCAGCG CCACCGTATA 
0361 CGGTGAGCCA AAGTTCCTG- CCCGTGACCG AGGAGCAT-C CCACGGGC-A ACTGTACA-T 
0421 CG-CCCTACG GCAAGACTAA ATATTTCACC GAGGAGATT- CTCAA-GGAT CTGTG-CAAG 
0481 TCTGACAAGC GTTGGGCAGT GGTTTCGC 
 Assemble Data

12030R-2.IR_full       1   CCACACGGTTCTGGAGATGCTCAATGCGGGCTACAACGTCATCTGCGTGGACAACCTGTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12030R-2.in silico     1   CCACACGGTTCTGGAGATGCTCAATGCGGGCTACAACGTCATCTGCGTGGACAACCTGTG 60


12030R-2.IR_full       61  CAACGCCTACAGCAGCGGGGCCAAATTGCCGGAGGCCCTCAGCCGGGTGCAGGAAATCAC 120
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
12030R-2.in silico     61  CAACGCCTACAGCAGCGGGGCCAAACTGCCGGAGGCCCTCAGCCGGGTGCAGGAAATCAC 120


12030R-2.IR_full       121 CGGCAAGAAGGTCAACTTCTATAGAGTGGACATCACGGACAGGGAGCAGGTGCGCTCCGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12030R-2.in silico     121 CGGCAAGAAGGTCAACTTCTATAGAGTGGACATCACGGACAGGGAGCAGGTGCGCTCCGT 180


12030R-2.IR_full       181 CTTCCAGGAGCACAAAATCGACATGGTGGCCCACTTTGCCGCCCTGAAGGCCGTGGGTGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12030R-2.in silico     181 CTTCCAGGAGCACAAAATCGACATGGTGGCCCACTTTGCCGCCCTGAAGGCCGTGGGTGA 240


12030R-2.IR_full       241 GTCCTGCCGCATACCTTTGCAATACTACCACAACAACATGACCGGCACCAATGTCCTGCT 300
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
12030R-2.in silico     241 GTCCTGCCGCATACCTTTGCAGTACTACCACAACAACATGACCGGCACCAATGTCCTGCT 300


12030R-2.IR_full       301 GGAGGTGATGGCCGACAACAATGTCTTCAAGTTCGTGTACAGCTCCAGTGCCACCGTCTA 360
                           ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||
12030R-2.in silico     301 GGAGGCGATGGCCGACAACAATGTCTTCAAGTTCGTGTACAGCTCCAGCGCCACCGTATA 360


12030R-2.IR_full       361 CGGTGAGCCAAAGTTCCTGCCCCGTGACCGAGGAGCATCCCCACGGGCAAACTGTACATT 420
                           ||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||| |
12030R-2.in silico     361 CGGTGAGCCAAAGTTCCTG-CCCGTGACCGAGGAGCAT-CCCACGGGC-AACTGTACA-T 420


12030R-2.IR_full       421 CGCCCCTACGGCAAGACTAAATATTTCACCGAGGAGATTCCTCAAGGGATCTGTGCCAAG 480
                           || |||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||
12030R-2.in silico     421 CG-CCCTACGGCAAGACTAAATATTTCACCGAGGAGATT-CTCAA-GGATCTGTG-CAAG 480


12030R-2.IR_full       481 TCTGACAAGCGTTGGGCAGTGGTTTBGC 508
                           ||||||||||||||||||||||||| ||
12030R-2.in silico     481 TCTGACAAGCGTTGGGCAGTGGTTTCGC 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   12  NM_139365.2  CG18330-RA (Cct2), mRNA 
0   10  NM_132111.2  CG4094-RA, transcript variant A (l(1)G0255), mRNA 
0   10  NM_167081.2  CG4094-RB, transcript variant B (l(1)G0255), mRNA 
0   NM_134498.2  CG14216-RA (CG14216), mRNA 
0   NM_205889.1  CG31665-RB, transcript variant B (CG31665), mRNA 
0   NM_164443.1  CG31665-RA, transcript variant A (CG31665), mRNA 
0   NM_140390.2  CG10725-RB (CG10725), mRNA 
0   NM_001038935.2  CG33989-RF, transcript variant F (pHCl), mRNA 
0   NM_001038936.2  CG33989-RE, transcript variant E (pHCl), mRNA 
0   NM_001038934.2  CG33989-RD, transcript variant D (pHCl), mRNA 
0   NM_001038937.1  CG33989-RC, transcript variant C (pHCl), mRNA 
0   NM_144017.1  CG18682-RA (CG18682), mRNA 
0   NM_166281.1  CG5170-RE, transcript variant E (Dp1), mRNA 
0   NM_166282.1  CG5170-RF, transcript variant F (Dp1), mRNA 
0   NM_166280.1  CG5170-RD, transcript variant D (Dp1), mRNA 
0   NM_206164.1  CG5170-RA, transcript variant A (Dp1), mRNA 
0   NM_079057.2  CG5170-RC, transcript variant C (Dp1), mRNA 
0   NM_206163.1  CG5170-RB, transcript variant B (Dp1), mRNA 
0   NM_079581.2  CG6538-RA (TfIIFbeta), mRNA 
0   NM_165935.1  CG8776-RB, transcript variant B (CG8776), mRNA 
0   NM_165936.1  CG8776-RC, transcript variant C (CG8776), mRNA 
0   NM_136964.2  CG8776-RE, transcript variant E (CG8776), mRNA 
0   NM_165934.1  CG8776-RA, transcript variant A (CG8776), mRNA 
0   NM_165937.1  CG8776-RD, transcript variant D (CG8776), mRNA 
0   NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
0   NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
0   NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.