National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12030R-2 
 Symbol CG12030  Full Name CG12030 
 CG No CG12030  Old CG No CG12030 
 Synonyms CG12030 
 Accession No (Link to NCBI) NM_138200.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Sanders RD, Sefton JM, Moberg KH, Fridovich-Keil JL.
UDP-galactose 4' epimerase (GALE) is essential for development of Drosophila melanogaster.
Dis Model Mech (2010) 3(9-10) 628-38 [ PubMed ID = 20519568 ] [ RRC reference ]

Daenzer JM, Sanders RD, Hang D, Fridovich-Keil JL.
UDP-galactose 4'-epimerase activities toward UDP-Gal and UDP-GalNAc play different roles in the development of Drosophila melanogaster.
PLoS Genet (2012) 8(5) e1002721 [ PubMed ID = 22654673 ] [ RRC reference ]

Mondal BC, Shim J, Evans CJ, Banerjee U.
Pvr expression regulators in equilibrium signal control and maintenance of Drosophila blood progenitors.
Elife (2014) 3 e03626 [ PubMed ID = 25201876 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCACACGGTTCTGGAGATGCTCAATGCGGGCTACAACGTCATCTGCGTGGACAACCTGTG 60

                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     61  CAACGCCTACAGCAGCGGGGCCAAACTGCCGGAGGCCCTCAGCCGGGTGCAGGAAATCAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGCAAGAAGGTCAACTTCTATAGAGTGGACATCACGGACAGGGAGCAGGTGCGCTCCGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTTCCAGGAGCACAAAATCGACATGGTGGCCCACTTTGCCGCCCTGAAGGCCGTGGGTGA 240

                           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     241 GTCCTGCCGCATACCTTTGCAGTACTACCACAACAACATGACCGGCACCAATGTCCTGCT 300

                           ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| || silico     301 GGAGGCGATGGCCGACAACAATGTCTTCAAGTTCGTGTACAGCTCCAGCGCCACCGTATA 360

                           ||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||| | silico     361 CGGTGAGCCAAAGTTCCTG-CCCGTGACCGAGGAGCAT-CCCACGGGC-AACTGTACA-T 420

                           || |||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||| silico     421 CG-CCCTACGGCAAGACTAAATATTTCACCGAGGAGATT-CTCAA-GGATCTGTG-CAAG 480

                           ||||||||||||||||||||||||| || silico     481 TCTGACAAGCGTTGGGCAGTGGTTTCGC 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   12  NM_139365.2  CG18330-RA (Cct2), mRNA 
0   10  NM_132111.2  CG4094-RA, transcript variant A (l(1)G0255), mRNA 
0   10  NM_167081.2  CG4094-RB, transcript variant B (l(1)G0255), mRNA 
0   NM_134498.2  CG14216-RA (CG14216), mRNA 
0   NM_205889.1  CG31665-RB, transcript variant B (CG31665), mRNA 
0   NM_164443.1  CG31665-RA, transcript variant A (CG31665), mRNA 
0   NM_140390.2  CG10725-RB (CG10725), mRNA 
0   NM_001038935.2  CG33989-RF, transcript variant F (pHCl), mRNA 
0   NM_001038936.2  CG33989-RE, transcript variant E (pHCl), mRNA 
0   NM_001038934.2  CG33989-RD, transcript variant D (pHCl), mRNA 
0   NM_001038937.1  CG33989-RC, transcript variant C (pHCl), mRNA 
0   NM_144017.1  CG18682-RA (CG18682), mRNA 
0   NM_166281.1  CG5170-RE, transcript variant E (Dp1), mRNA 
0   NM_166282.1  CG5170-RF, transcript variant F (Dp1), mRNA 
0   NM_166280.1  CG5170-RD, transcript variant D (Dp1), mRNA 
0   NM_206164.1  CG5170-RA, transcript variant A (Dp1), mRNA 
0   NM_079057.2  CG5170-RC, transcript variant C (Dp1), mRNA 
0   NM_206163.1  CG5170-RB, transcript variant B (Dp1), mRNA 
0   NM_079581.2  CG6538-RA (TfIIFbeta), mRNA 
0   NM_165935.1  CG8776-RB, transcript variant B (CG8776), mRNA 
0   NM_165936.1  CG8776-RC, transcript variant C (CG8776), mRNA 
0   NM_136964.2  CG8776-RE, transcript variant E (CG8776), mRNA 
0   NM_165934.1  CG8776-RA, transcript variant A (CG8776), mRNA 
0   NM_165937.1  CG8776-RD, transcript variant D (CG8776), mRNA 
0   NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
0   NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
0   NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.