National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12028R-1 
 Symbol dib  Full Name disembodied 
 CG No CG12028  Old CG No CG12028 
 Synonyms Cyp302a1, CYP302A1, 302a1, CG12028, l(3)dib, l(3)SH14, l(3)64Ak, dib 
 Accession No (Link to NCBI) NM_080071.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCACGAGGACCCTTTGGAAT 
 Primer Seq. 3'
aatctagaggtaccGAGCTCCAAAGGTAAGCAAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCACGAGGA CCCTTTGGAA TGGGTAATCT ATACAATTAC CTGCCCGGAA TCGGATCCTA 
0061 TTCCTGGCTA AGATTGCACC AAGCCGGCCA GGATAAGTAT GAGAAATATG GCGCAATTGT 
0121 GCGGGAAACT ATAGTTCCTG GGCAGGACAT TGTCTGGTTG TACGATCCCA AGGACATAGC 
0181 TTTGCTGCTC AACGAGCGGG ATTGTCCGCA GCGAAGAAGT CACCTGGCAC TGGCTCAATA 
0241 TCGCAAGAGC CGACCGGATG TCTATAAAAC CACCGGCTTG CTGCCCACCA ATGGTCCGGA 
0301 ATGGTGGCGT ATACGTGCCC AGGTGCAAAA GGAGCTGAGT GCACCAAAGA GTGTGCGGAA 
0361 CTTCGTTCGC CAAGTGGATG GAGTGACCAA GGAGTTCATT AGATTTCTAC AAGAATCTCG 
0421 CAATGGTGGT GCCATTGATA TGCTGCCCAA GCTCACCAGA TTGAATTTGG AATTAACCTG 
0481 TTTGCTTACC TTTGGAGCTC  
 in silico PCR Fragment
0001 ACCACGAGGA CCCTTTGGAA TGGGTAATCT ATACAATTAC CTGCCCGGAA TCGGATCCTA 
0061 TTCCTGGCTA AGATTGCACC AAGCCGGCCA GGATAAGTAT GAGAAATATG GCGCAATTGT 
0121 GCGGGAAACT ATAGTTCCTG GGCAGGACAT TGTCTGGTTG TACGATCCCA AGGACATAGC 
0181 TTTGCTGCTC AACGAGCGGG ATTGTCCGCA GCGAAGAAGT CACCTGGCAC TGGCTCAATA 
0241 TCGCAAGAGC CGACCGGATG TCTATAAAAC CACCGGCTTG CTGCCCACCA ATGGTCCGGA 
0301 ATGGTGGCGT ATACGTGCCC AGGTGCAAAA GGAGCTGAGT GCACCAAAGA GTGTGCGGAA 
0361 CTTTGTTCGC CAAGTGGATG GAGTGACCAA GGAGTTCATT AGATTTCTAC AAGAATCTCG 
0421 CAATGGTGGT GCCATTGATA TGCTGCCCAA GCTCACCAGA TTGAATTTGG AATTAACCTG 
0481 TTTGCTTACC TTTGGAGCTC  
 Assemble Data

12028R-1.IR_full       1   ACCACGAGGACCCTTTGGAATGGGTAATCTATACAATTACCTGCCCGGAATCGGATCCTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     1   ACCACGAGGACCCTTTGGAATGGGTAATCTATACAATTACCTGCCCGGAATCGGATCCTA 60


12028R-1.IR_full       61  TTCCTGGCTAAGATTGCACCAAGCCGGCCAGGATAAGTATGAGAAATATGGCGCAATTGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     61  TTCCTGGCTAAGATTGCACCAAGCCGGCCAGGATAAGTATGAGAAATATGGCGCAATTGT 120


12028R-1.IR_full       121 GCGGGAAACTATAGTTCCTGGGCAGGACATTGTCTGGTTGTACGATCCCAAGGACATAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     121 GCGGGAAACTATAGTTCCTGGGCAGGACATTGTCTGGTTGTACGATCCCAAGGACATAGC 180


12028R-1.IR_full       181 TTTGCTGCTCAACGAGCGGGATTGTCCGCAGCGAAGAAGTCACCTGGCACTGGCTCAATA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     181 TTTGCTGCTCAACGAGCGGGATTGTCCGCAGCGAAGAAGTCACCTGGCACTGGCTCAATA 240


12028R-1.IR_full       241 TCGCAAGAGCCGACCGGATGTCTATAAAACCACCGGCTTGCTGCCCACCAATGGTCCGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     241 TCGCAAGAGCCGACCGGATGTCTATAAAACCACCGGCTTGCTGCCCACCAATGGTCCGGA 300


12028R-1.IR_full       301 ATGGTGGCGTATACGTGCCCAGGTGCAAAAGGAGCTGAGTGCACCAAAGAGTGTGCGGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     301 ATGGTGGCGTATACGTGCCCAGGTGCAAAAGGAGCTGAGTGCACCAAAGAGTGTGCGGAA 360


12028R-1.IR_full       361 CTTCGTTCGCCAAGTGGATGGAGTGACCAAGGAGTTCATTAGATTTCTACAAGAATCTCG 420
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     361 CTTTGTTCGCCAAGTGGATGGAGTGACCAAGGAGTTCATTAGATTTCTACAAGAATCTCG 420


12028R-1.IR_full       421 CAATGGTGGTGCCATTGATATGCTGCCCAAGCTCACCAGATTGAATTTGGAATTAACCTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12028R-1.in silico     421 CAATGGTGGTGCCATTGATATGCTGCCCAAGCTCACCAGATTGAATTTGGAATTAACCTG 480


12028R-1.IR_full       481 TTTGCTTACCTTTGGAGCTC 500
                           ||||||||||||||||||||
12028R-1.in silico     481 TTTGCTTACCTTTGGAGCTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080071.2  CG12028-RA (dib), mRNA 
0   NM_057311.4  CG6246-RA (nub), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_206121.2  CG33461-RA (CG33461), mRNA 
0   NM_143149.1  CG5071-RB, transcript variant B (CG5071), mRNA 
0   NM_170232.1  CG5071-RA, transcript variant A (CG5071), mRNA 
0   NM_165847.1  CG8996-RA, transcript variant A (wal), mRNA 
0   NM_057627.3  CG8996-RB, transcript variant B (wal), mRNA 
0   NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_079032.2  CG18250-RA, transcript variant A (Dg), mRNA 
0   NM_166138.3  CG18250-RB, transcript variant B (Dg), mRNA 
0   NM_164850.2  CG4454-RB, transcript variant B (Borr), mRNA 
0   NM_135435.3  CG4454-RA, transcript variant A (Borr), mRNA 
0   NM_057389.4  CG1391-RA, transcript variant A (sol), mRNA 
0   NM_206801.1  CG1391-RD, transcript variant D (sol), mRNA 
0   NM_206802.1  CG1391-RC, transcript variant C (sol), mRNA 
0   NM_057390.4  CG1391-RB, transcript variant B (sol), mRNA 
0   11  NM_140101.1  CG14168-RA (CG14168), mRNA 
0   NM_136455.1  CG2093-RA (CG2093), mRNA 
0   NM_140465.2  CG9311-RA (CG9311), mRNA 
0   NM_140521.1  CG6498-RA (CG6498), mRNA 
0   NM_134676.1  CG4213-RA (CG4213), mRNA 
0   NM_143597.1  CG15563-RA (CG15563), mRNA 
0   NM_137687.2  CG15651-RA (CG15651), mRNA 
0   NM_001043069.1  CG34141-RA (CG34141), mRNA 
0   NM_140006.1  CG5751-RA (TrpA1), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_140041.2  CG4432-RB, transcript variant B (PGRP-LC), mRNA 
0   NM_138181.1  CG13882-RA (CG13882), mRNA 
0   NM_080088.1  CG6577-RA (can), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.