National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12015R-3 
 Symbol RabX6  Full Name RabX6 
 CG No CG12015  Old CG No CG12015 
 Synonyms CG12015, DmRabX6, RabX6 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACGATGCGCATACCCAAACA 
 Primer Seq. 3'
aatctagaggtaccCACGGAACATCTCCTCCACAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACGATGCGC ATACCCAAAC AGAAGGTGAT CCTGTGCGGA GACTACGGAG TGGGCAAGAG 
0061 CTCCCTGTTC CGGCGCTTCG CCACCAACAC CTTCATCACG GATACGGACA GGAAATCCAC 
0121 GTTGGGACTG GACCACATCG ATAGGGAATA CAGTGTGAAT GAAAAGCAAA TCAAGCTCCA 
0181 ACTCTGGGAC ACCGGTGGCA TGGAGCGTGT GGCCTCGGTC ACATCCTCGT ACTACAAGTT 
0241 CGCCGAGGGA GCCATCCTGG TCTTTGCTTT GGACAACGCC GCTTCGTTCC ACTCGCTGTC 
0301 GCAGCACTTG CTGGACATTG TGACCTATGC AGAGAATGCC AAGATCTTCA TCTGTGGCAA 
0361 TAAGAGCGAT CTGGATGGCA GGGAGCCGGA GGTCAGCGAT GAGGAAGTGG AGGCCTTCTG 
0421 CGAGCAGTGC CACTCACTGA TCAGTGCCAC GTACAAGACC TCCTGTCGCA GCGGCGCCGG 
0481 TGTGGAGGAG ATGTTCCGTG  
 in silico PCR Fragment
0001 CACGATGCGC ATACCCAAAC AAAAGGTGAT CCTGTGCGGC GACTACGGAG TGGGCAAGAG 
0061 CTCCCTGTTC CGGCGCTTCG CCACCAACAC CTTCATCACG GATACGGACA GGAAATCCAC 
0121 GTTGGGACTG GACCACATCG ATAGGGAATA CAGTGTGAAT GAAAAGCAGA TCAAGCTCCA 
0181 ACTCTGGGAC ACCGGTGGCA TGGAGCGTGT GGCCTCGGTC ACATCCTCGT ACTACAAGTT 
0241 CGCCGAGGGA GCCATCCTGG TCTTTGCTTT GGACAACGCC GCTTCGTTCC ACTCGCTGTC 
0301 GCAGCACTTG CTGGACATTG TGACCTATGC AGAGAATGCC AAGATCTTCA TCTGTGGCAA 
0361 TAAGAGCGAT CTGGATGGCA GGGAGCCGGA GGTCAGCGAT GAGGAAGTGG AGGCCTTCTG 
0421 CGAGCAGTGC CACTCACTGA TCAGTGCCAC GTACAAGACC TCCTGTCGCA GCGGCGCCGG 
0481 TGTGGAGGAG ATGTTCCGTG  
 Assemble Data

12015R-3.IR full       1   CACGATGCGCATACCCAAACAGAAGGTGATCCTGTGCGGAGACTACGGAGTGGGCAAGAG 60
                           ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
12015R-3.in silico     1   CACGATGCGCATACCCAAACAAAAGGTGATCCTGTGCGGCGACTACGGAGTGGGCAAGAG 60


12015R-3.IR full       61  CTCCCTGTTCCGGCGCTTCGCCACCAACACCTTCATCACGGATACGGACAGGAAATCCAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12015R-3.in silico     61  CTCCCTGTTCCGGCGCTTCGCCACCAACACCTTCATCACGGATACGGACAGGAAATCCAC 120


12015R-3.IR full       121 GTTGGGACTGGACCACATCGATAGGGAATACAGTGTGAATGAAAAGCAAATCAAGCTCCA 180
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
12015R-3.in silico     121 GTTGGGACTGGACCACATCGATAGGGAATACAGTGTGAATGAAAAGCAGATCAAGCTCCA 180


12015R-3.IR full       181 ACTCTGGGACACCGGTGGCATGGAGCGTGTGGCCTCGGTCACATCCTCGTACTACAAGTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12015R-3.in silico     181 ACTCTGGGACACCGGTGGCATGGAGCGTGTGGCCTCGGTCACATCCTCGTACTACAAGTT 240


12015R-3.IR full       241 CGCCGAGGGAGCCATCCTGGTCTTTGCTTTGGACAACGCCGCTTCGTTCCACTCGCTGTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12015R-3.in silico     241 CGCCGAGGGAGCCATCCTGGTCTTTGCTTTGGACAACGCCGCTTCGTTCCACTCGCTGTC 300


12015R-3.IR full       301 GCAGCACTTGCTGGACATTGTGACCTATGCAGAGAATGCCAAGATCTTCATCTGTGGCAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12015R-3.in silico     301 GCAGCACTTGCTGGACATTGTGACCTATGCAGAGAATGCCAAGATCTTCATCTGTGGCAA 360


12015R-3.IR full       361 TAAGAGCGATCTGGATGGCAGGGAGCCGGAGGTCAGCGATGAGGAAGTGGAGGCCTTCTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12015R-3.in silico     361 TAAGAGCGATCTGGATGGCAGGGAGCCGGAGGTCAGCGATGAGGAAGTGGAGGCCTTCTG 420


12015R-3.IR full       421 CGAGCAGTGCCACTCACTGATCAGTGCCACGTACAAGACCTCCTGTCGCAGCGGCGCCGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12015R-3.in silico     421 CGAGCAGTGCCACTCACTGATCAGTGCCACGTACAAGACCTCCTGTCGCAGCGGCGCCGG 480


12015R-3.IR full       481 TGTGGAGGAGATGTTCCGTG 500
                           ||||||||||||||||||||
12015R-3.in silico     481 TGTGGAGGAGATGTTCCGTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.