National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1200R-2 
 Symbol Aplip1  Full Name APP-like protein interacting protein 1 
 CG No CG1200  Old CG No CG1200 
 Synonyms Jip1/2, APLIP1, aplip1, SP512, CG1200, dp1, ek4, E(Khc)ek4, EK4, Ek4, Aplip1 
 Accession No (Link to NCBI) NM_167857.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGAATTCGAGGAGTTCCACA 
 Primer Seq. 3'
aatctagaggtaccGGAGCCAAAGTTGGAGCCACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGAATTCGA GGAGTTCCAC AGGCCCATAT TTGAGCCACA TACGATTGCT GGATTCGGAT 
0061 CAGGAGCAGG CAGCAAGAAG AATAATCCAC ATGCATTTTA CTCCTTAATT CCCAACGATG 
0121 ACCTGGAGGA CTCGCACTCC TCGAAGANCG ATGGCGACGG TTCGGATCAG GAGGATGGCA 
0181 TTGGTCTTGT GGATCACGAG CCCAAGATGC GTCAAGTGGA GGACGATGAG CTGGGCGACG 
0241 GGCTGAAAGT CACTCTGTCC TCGGACGGCT CGCTGGACAC CAACGACTCG TTTAATTCGC 
0301 ACCGACATCA TCCGTTGAAC CACCAGGATG CGATTGGTGG CTTCCTGGGC ATGGACACCA 
0361 GTGGATTGGG TGGCAATAGT GCACCTGTGA CCATTGGAGC CAGCACAGAT CTGCTGGCAC 
0421 CCAATACAGC TGCCACGCGA CGTCGTCGCA AGTTGCCGGA AATACCGAAA AACAAGAAAT 
0481 GTGGCTCCAA CTTTGGCTCC  
 in silico PCR Fragment
0001 GCGAATTCGA GGAGTTCCAC AGGCCCATAT TTGAGCCACA TACGATTGCT GGATTCGGAT 
0061 CAGGAGCAGG CAGCAAGAAG AATAATCCAC ATGCATTTTA CTCCTTAATT CCCAACGATG 
0121 ACCTGGAGGA CTCGCACTCC TCGAAGAGCG ATGGCGACGG TTCGGATCAG GAGGATGGCA 
0181 TTGGTCTTGT GGATCACGAG CCCAAGATGC GTCAAGTGGA GGACGATGAG CTGGGCGACG 
0241 GGCTGAAAGT CACTCTGTCC TCGGACGGCT CGCTGGACAC CAACGACTCG TTTAATTCGC 
0301 ACCGACATCA TCCGTTGAAC CACCAGGATG CGATTGGTGG CTTCCTGGGC ATGGACACCA 
0361 GTGGATTGGG TGGCAATAGT GCACCTGTGA CCATTGGAGC CAGCACAGAT CTGCTGGCAC 
0421 CCAATACAGC TGCCACGCGA CGTCGTCGCA AGTTGCCGGA AATACCGAAA AACAAGAAAT 
0481 GTGGCTCCAA CTTTGGCTCC  
 Assemble Data

1200R-2.IR_full       1   GCGAATTCGAGGAGTTCCACAGGCCCATATTTGAGCCACATACGATTGCTGGATTCGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1200R-2.in silico     1   GCGAATTCGAGGAGTTCCACAGGCCCATATTTGAGCCACATACGATTGCTGGATTCGGAT 60


1200R-2.IR_full       61  CAGGAGCAGGCAGCAAGAAGAATAATCCACATGCATTTTACTCCTTAATTCCCAACGATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1200R-2.in silico     61  CAGGAGCAGGCAGCAAGAAGAATAATCCACATGCATTTTACTCCTTAATTCCCAACGATG 120


1200R-2.IR_full       121 ACCTGGAGGACTCGCACTCCTCGAAGANCGATGGCGACGGTTCGGATCAGGAGGATGGCA 180
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
1200R-2.in silico     121 ACCTGGAGGACTCGCACTCCTCGAAGAGCGATGGCGACGGTTCGGATCAGGAGGATGGCA 180


1200R-2.IR_full       181 TTGGTCTTGTGGATCACGAGCCCAAGATGCGTCAAGTGGAGGACGATGAGCTGGGCGACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1200R-2.in silico     181 TTGGTCTTGTGGATCACGAGCCCAAGATGCGTCAAGTGGAGGACGATGAGCTGGGCGACG 240


1200R-2.IR_full       241 GGCTGAAAGTCACTCTGTCCTCGGACGGCTCGCTGGACACCAACGACTCGTTTAATTCGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1200R-2.in silico     241 GGCTGAAAGTCACTCTGTCCTCGGACGGCTCGCTGGACACCAACGACTCGTTTAATTCGC 300


1200R-2.IR_full       301 ACCGACATCATCCGTTGAACCACCAGGATGCGATTGGTGGCTTCCTGGGCATGGACACCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1200R-2.in silico     301 ACCGACATCATCCGTTGAACCACCAGGATGCGATTGGTGGCTTCCTGGGCATGGACACCA 360


1200R-2.IR_full       361 GTGGATTGGGTGGCAATAGTGCACCTGTGACCATTGGAGCCAGCACAGATCTGCTGGCAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1200R-2.in silico     361 GTGGATTGGGTGGCAATAGTGCACCTGTGACCATTGGAGCCAGCACAGATCTGCTGGCAC 420


1200R-2.IR_full       421 CCAATACAGCTGCCACGCGACGTCGTCGCAAGTTGCCGGAAATACCGAAAAACAAGAAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1200R-2.in silico     421 CCAATACAGCTGCCACGCGACGTCGTCGCAAGTTGCCGGAAATACCGAAAAACAAGAAAT 480


1200R-2.IR_full       481 GTGGCTCCAACTTTGGCTCC 500
                          ||||||||||||||||||||
1200R-2.in silico     481 GTGGCTCCAACTTTGGCTCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167857.1  CG1200-RA, transcript variant A (Aplip1), mRNA 
96.26   464  NM_167856.1  CG1200-RB, transcript variant B (Aplip1), mRNA 
0.41   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0.41   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   NM_137980.2  CG12491-RA (CG12491), mRNA 
0   NM_001043102.1  CG34105-RA (CG34105), mRNA 
0   NM_135671.1  CG12602-RA (CG12602), mRNA 
0   NM_141756.3  CG31272-RA (CG31272), mRNA 
0   NM_057257.3  CG7664-RA (crp), mRNA 
0   NM_142415.2  CG7780-RA (DNaseII), mRNA 
0   NM_136359.2  CG7843-RA, transcript variant A (CG7843), mRNA 
0   NM_165460.1  CG7843-RB, transcript variant B (CG7843), mRNA 
0   NM_165459.1  CG7843-RD, transcript variant D (CG7843), mRNA 
0   NM_165458.1  CG7843-RC, transcript variant C (CG7843), mRNA 
0   NM_079727.2  CG6932-RA (CSN6), mRNA 
0   NM_132134.2  CG4558-RA (CG4558), mRNA 
0   NM_140452.2  CG13478-RA, transcript variant A (shd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.