National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1200R-2 
 Symbol Aplip1  Full Name APP-like protein interacting protein 1 
 CG No CG1200  Old CG No CG1200 
 Synonyms Jip1/2, APLIP1, aplip1, SP512, CG1200, dp1, ek4, E(Khc)ek4, EK4, Ek4, Aplip1 
 Accession No (Link to NCBI) NM_167857.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCGAATTCGAGGAGTTCCACAGGCCCATATTTGAGCCACATACGATTGCTGGATTCGGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGGAGCAGGCAGCAAGAAGAATAATCCACATGCATTTTACTCCTTAATTCCCAACGATG 120

                          ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     121 ACCTGGAGGACTCGCACTCCTCGAAGAGCGATGGCGACGGTTCGGATCAGGAGGATGGCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTGGTCTTGTGGATCACGAGCCCAAGATGCGTCAAGTGGAGGACGATGAGCTGGGCGACG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCTGAAAGTCACTCTGTCCTCGGACGGCTCGCTGGACACCAACGACTCGTTTAATTCGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACCGACATCATCCGTTGAACCACCAGGATGCGATTGGTGGCTTCCTGGGCATGGACACCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGGATTGGGTGGCAATAGTGCACCTGTGACCATTGGAGCCAGCACAGATCTGCTGGCAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCAATACAGCTGCCACGCGACGTCGTCGCAAGTTGCCGGAAATACCGAAAAACAAGAAAT 480

1200R-2.IR_full       481 GTGGCTCCAACTTTGGCTCC 500
                          |||||||||||||||||||| silico     481 GTGGCTCCAACTTTGGCTCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167857.1  CG1200-RA, transcript variant A (Aplip1), mRNA 
96.26   464  NM_167856.1  CG1200-RB, transcript variant B (Aplip1), mRNA 
0.41   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0.41   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   NM_137980.2  CG12491-RA (CG12491), mRNA 
0   NM_001043102.1  CG34105-RA (CG34105), mRNA 
0   NM_135671.1  CG12602-RA (CG12602), mRNA 
0   NM_141756.3  CG31272-RA (CG31272), mRNA 
0   NM_057257.3  CG7664-RA (crp), mRNA 
0   NM_142415.2  CG7780-RA (DNaseII), mRNA 
0   NM_136359.2  CG7843-RA, transcript variant A (CG7843), mRNA 
0   NM_165460.1  CG7843-RB, transcript variant B (CG7843), mRNA 
0   NM_165459.1  CG7843-RD, transcript variant D (CG7843), mRNA 
0   NM_165458.1  CG7843-RC, transcript variant C (CG7843), mRNA 
0   NM_079727.2  CG6932-RA (CSN6), mRNA 
0   NM_132134.2  CG4558-RA (CG4558), mRNA 
0   NM_140452.2  CG13478-RA, transcript variant A (shd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.