National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11966R-3 
 Symbol CG11966  Full Name CG11966 
 CG No CG11966  Old CG No CG11966 
 Synonyms CG11966 
 Accession No (Link to NCBI) NM_141591.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTATCTGCTCGATGGACACAA 
 Primer Seq. 3'
aatctagaggtaccAGCTATCGGCCACGGAGTAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTATCTGCTC GATGGACACA AGCTGTTGCT GGAGCATGAC CTGGACTCCC TGCCAAGTGA 
0061 TGCGGATCAG AAAAACTCGC TGGACGTGCT GGACAATCTG CTGCTGAATG GATCGTCGCT 
0121 GAATGCGCTG TCGGATCTAA AGCCACTGCC GCCCTTCACA GGCTACACGG GCCACCTGTC 
0181 CATCAATGGG ATCTCCGGCC ACCATTATCA TGCCATTGCC CAGAGACTGC CGGATGAGAG 
0241 CAACAACAAC TACATGCAGA GTGCCTATCA CCCGCAGAAC CAATCGAATC CCACATCCAC 
0301 CACGCAATCG AATGGGGGCA GCAATAGCAA CTCCAACAAC TCCAATGAGC ACAACATAGT 
0361 ATCCTCCTCC ACCTGCTTAC CAGAAAGTGT ACTCAGCGGG AGCGGCGGAG GAGGAGGTGG 
0421 CAACGATGCC TGcCNGGCGG ACGTGAAGCT CTTCGCCGAT AGTCAACTAG ATTCTAAGCT 
0481 TTACTCCGTG GCCGATAGCT  
 in silico PCR Fragment
0001 GTATCTGCTC GATGGACACA AGCTGTTGCT GGAGCATGAC CTGGACTCCC TGCCAAGTGA 
0061 TGCGGATCAG AAAAACTCGC TGGACGTGCT GGACAATCTG CTGCTGAATG GATCGTCGCT 
0121 GAATGCGCTG TCGGATCTAA AGCCACTGCC GCCCTTCACA GGCTACACGG GCCACCTGTC 
0181 CATCAATGGG ATCTCCGGCC ACCATTATCA TGCCATTGCC CAGAGACTGC CGGATGAGAG 
0241 CAACAACAAC TACATGCAGA GTGCCTATCA CCCGCAGAAC CAATCGAATC CCACATCCAC 
0301 CACGCAATCG AATGGGGGCA GCAATAGCAA CTCCAACAAC TCCAATGAGC ACAACATAGT 
0361 ATCCTCCTCC ACCTGCTTAC CAGAAAGTGT ACTCAGCGGG AGCGGCGGAG GAGGAGGTGG 
0421 CAACGATGCC TGCCTGGCGG ACGTGAAGCT CTTCGCCGAT AGTCAACTAG ATTCTAAGCT 
0481 TTACTCCGTG GCCGATAGCT  
 Assemble Data

11966R-3.IR_full       1   GTATCTGCTCGATGGACACAAGCTGTTGCTGGAGCATGACCTGGACTCCCTGCCAAGTGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     1   GTATCTGCTCGATGGACACAAGCTGTTGCTGGAGCATGACCTGGACTCCCTGCCAAGTGA 60


11966R-3.IR_full       61  TGCGGATCAGAAAAACTCGCTGGACGTGCTGGACAATCTGCTGCTGAATGGATCGTCGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     61  TGCGGATCAGAAAAACTCGCTGGACGTGCTGGACAATCTGCTGCTGAATGGATCGTCGCT 120


11966R-3.IR_full       121 GAATGCGCTGTCGGATCTAAAGCCACTGCCGCCCTTCACAGGCTACACGGGCCACCTGTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     121 GAATGCGCTGTCGGATCTAAAGCCACTGCCGCCCTTCACAGGCTACACGGGCCACCTGTC 180


11966R-3.IR_full       181 CATCAATGGGATCTCCGGCCACCATTATCATGCCATTGCCCAGAGACTGCCGGATGAGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     181 CATCAATGGGATCTCCGGCCACCATTATCATGCCATTGCCCAGAGACTGCCGGATGAGAG 240


11966R-3.IR_full       241 CAACAACAACTACATGCAGAGTGCCTATCACCCGCAGAACCAATCGAATCCCACATCCAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     241 CAACAACAACTACATGCAGAGTGCCTATCACCCGCAGAACCAATCGAATCCCACATCCAC 300


11966R-3.IR_full       301 CACGCAATCGAATGGGGGCAGCAATAGCAACTCCAACAACTCCAATGAGCACAACATAGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     301 CACGCAATCGAATGGGGGCAGCAATAGCAACTCCAACAACTCCAATGAGCACAACATAGT 360


11966R-3.IR_full       361 ATCCTCCTCCACCTGCTTACCAGAAAGTGTACTCAGCGGGAGCGGCGGAGGAGGAGGTGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     361 ATCCTCCTCCACCTGCTTACCAGAAAGTGTACTCAGCGGGAGCGGCGGAGGAGGAGGTGG 420


11966R-3.IR_full       421 CAACGATGCCTGCCNGGCGGACGTGAAGCTCTTCGCCGATAGTCAACTAGATTCTAAGCT 480
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
11966R-3.in silico     421 CAACGATGCCTGCCTGGCGGACGTGAAGCTCTTCGCCGATAGTCAACTAGATTCTAAGCT 480


11966R-3.IR_full       481 TTACTCCGTGGCCGATAGCT 500
                           ||||||||||||||||||||
11966R-3.in silico     481 TTACTCCGTGGCCGATAGCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141591.1  CG11966-RA (CG11966), mRNA 
0.41   NM_132073.1  CG14445-RA (CG14445), mRNA 
0.41   13  NM_132246.2  CG10555-RA (CG10555), mRNA 
0.41   13  NM_142622.1  CG4360-RA (CG4360), mRNA 
0.41   NM_057398.3  CG8049-RA, transcript variant A (Btk29A), mRNA 
0.41   NM_164805.1  CG8049-RC, transcript variant C (Btk29A), mRNA 
0.41   NM_164804.1  CG8049-RD, transcript variant D (Btk29A), mRNA 
0.41   NM_057397.3  CG8049-RB, transcript variant B (Btk29A), mRNA 
0.2   NM_079956.2  CG18455-RA, transcript variant A (Optix), mRNA 
0.2   NM_165584.1  CG18455-RB, transcript variant B (Optix), mRNA 
0.2   14  NM_001014706.1  CG13376-RA (CG13376), mRNA 
0.2   12  NM_140759.2  CG5546-RA (MED19), mRNA 
0.2   12  NM_142649.2  CG4000-RA (CG4000), mRNA 
0.2   12  NM_141009.2  CG32432-RA (CG32432), mRNA 
0   NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0   NM_140587.1  CG5151-RA, transcript variant A (CG5151), mRNA 
0   15  35  NM_079093.2  CG9888-RA (Fib), mRNA 
0   33  NM_144026.1  CG11458-RA (CG11458), mRNA 
0   11  NM_136202.4  CG31678-RA (CG31678), mRNA 
0   10  23  NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   10  23  NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   10  23  NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   29  NM_142751.1  CG5778-RA (CG5778), mRNA 
0   NM_080124.3  CG31695-RA (scw), mRNA 
0   17  NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0   17  NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   17  NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0   17  NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0   11  NM_133012.2  CG32560-RA (CG32560), mRNA 
0   NM_139646.1  CG12607-RB (CG12607), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.