National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11966R-1 
 Symbol CG11966  Full Name CG11966 
 CG No CG11966  Old CG No CG11966 
 Synonyms CG11966 
 Accession No (Link to NCBI) NM_141591.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTATCTGCTCGATGGACACAAGCTGTTGCTGGAGCATGACCTGGACTCCCTGCCAAGTGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGCGGATCAGAAAAACTCGCTGGACGTGCTGGACAATCTGCTGCTGAATGGATCGTCGCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAATGCGCTGTCGGATCTAAAGCCACTGCCGCCCTTCACAGGCTACACGGGCCACCTGTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATCAATGGGATCTCCGGCCACCATTATCATGCCATTGCCCAGAGACTGCCGGATGAGAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAACAACAACTACATGCAGAGTGCCTATCACCCGCAGAACCAATCGAATCCCACATCCAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CACGCAATCGAATGGGGGCAGCAATAGCAACTCCAACAACTCCAATGAGCACAACATAGT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATCCTCCTCCACCTGCTTACCAGAAAGTGTACTCAGCGGGAGCGGCGGAGGAGGAGGTGG 420

                           |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAACGATGCCTGCCTGGCGGACGTGAAGCTCTTCGCCGATAGTCAACTAGATTCTAAGCT 480

11966R-1.IR_full       481 TTACTCCGTGGCCGATAGCT 500
                           |||||||||||||||||||| silico     481 TTACTCCGTGGCCGATAGCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141591.1  CG11966-RA (CG11966), mRNA 
0.41   NM_132073.1  CG14445-RA (CG14445), mRNA 
0.41   13  NM_132246.2  CG10555-RA (CG10555), mRNA 
0.41   13  NM_142622.1  CG4360-RA (CG4360), mRNA 
0.41   NM_057398.3  CG8049-RA, transcript variant A (Btk29A), mRNA 
0.41   NM_164805.1  CG8049-RC, transcript variant C (Btk29A), mRNA 
0.41   NM_164804.1  CG8049-RD, transcript variant D (Btk29A), mRNA 
0.41   NM_057397.3  CG8049-RB, transcript variant B (Btk29A), mRNA 
0.2   NM_079956.2  CG18455-RA, transcript variant A (Optix), mRNA 
0.2   NM_165584.1  CG18455-RB, transcript variant B (Optix), mRNA 
0.2   14  NM_001014706.1  CG13376-RA (CG13376), mRNA 
0.2   12  NM_140759.2  CG5546-RA (MED19), mRNA 
0.2   12  NM_142649.2  CG4000-RA (CG4000), mRNA 
0.2   12  NM_141009.2  CG32432-RA (CG32432), mRNA 
0   NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0   NM_140587.1  CG5151-RA, transcript variant A (CG5151), mRNA 
0   15  35  NM_079093.2  CG9888-RA (Fib), mRNA 
0   33  NM_144026.1  CG11458-RA (CG11458), mRNA 
0   11  NM_136202.4  CG31678-RA (CG31678), mRNA 
0   10  23  NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   10  23  NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   10  23  NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   29  NM_142751.1  CG5778-RA (CG5778), mRNA 
0   NM_080124.3  CG31695-RA (scw), mRNA 
0   17  NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0   17  NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   17  NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0   17  NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0   11  NM_133012.2  CG32560-RA (CG32560), mRNA 
0   NM_139646.1  CG12607-RB (CG12607), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.