National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11963R-3 
 Symbol CG11963  Full Name CG11963 
 CG No CG11963  Old CG No CG11963 
 Synonyms CG11963 
 Accession No (Link to NCBI) NM_141589.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTAGGCCAGCGGCCATAAAA 
 Primer Seq. 3'
aatctagaggtaccGCAGCCACCTCCTCAATATCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTAGGCCAG CGGCCATAAA AAAGATTCTT GGCCTGGCTC CCATCGCCGT CCAGCAGCTG 
0061 AGGAACCTCA ATGTCCAGGA ACACGTTTCC TACAGTCTGC TCAATGAGGC CAAGATCCCA 
0121 ACACCTCGTT TCGCTGTTGC CAAGAACGGC AAGGAGGCCA ACGATATCGC CACCAAGCTG 
0181 AAGACCGATA ACCTGGTGCT GAAGGCTCAG GTTTTGGCCG GAGGACGAGG CAAAGGAACC 
0241 TTTAAGAATG GCCTGAAGGG AGGTGTGCGA GTGGTCTACG ATCCCCAGAC CGCTGAAGAA 
0301 CTTTCAAGCA AAATGATTGA TCAGCTTCTG GTCACCAAGC AAACCGGAGC AGCCGGTCGC 
0361 ATCTGCAAAA AGGTGATGGT TGCCGAAAGG AAGTTCCCCC GCCGTGAGTT CTACTTCGCC 
0421 GTGATGATGG AGCGTGCCTT TAACGGTCCC GTGCTGATCG CCTCCAAGGA GGGTGGTGTT 
0481 GATATTGAGG AGGTGGNTGC  
 in silico PCR Fragment
0001 GTTAGGCCAG CGGCCATAAA AAAGATTCTT GGCCTGGCTC CCATCGCCGT CCAGCAGCTG 
0061 AGGAACCTCA ATGTCCAGGA ACACGTTTCC TACAGTCTGC TCAATGAGGC CAAGATCCCA 
0121 ACACCTCGTT TCGCTGTTGC CAAGAACGGC AAGGAGGCCA ACGATATCGC CACCAAGCTG 
0181 AAGACCGATA ACCTGGTGCT GAAGGCTCAG GTTTTGGCCG GAGGACGAGG CAAAGGAACC 
0241 TTTAAGAATG GCCTGAAGGG AGGTGTGCGA GTGGTCTACG ATCCCCAGAC CGCTGAAGAA 
0301 CTTTCAAGCA AAATGATCGA TCAGCTTCTG GTCACCAAGC AAACCGGAGC AGCCGGTCGC 
0361 ATCTGCAAAA AGGTGATGGT TGCCGAAAGG AAGTTCCCCC GCCGTGAGTT CTACTTCGCC 
0421 GTGATGATGG AGCGTGCCTT TAACGGTCCC GTGCTGATCG CCTCCAAGGA GGGTGGTGTT 
0481 GATATTGAGG AGGTGGCTGC  
 Assemble Data

11963R-3.IR_full       1   GTTAGGCCAGCGGCCATAAAAAAGATTCTTGGCCTGGCTCCCATCGCCGTCCAGCAGCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     1   GTTAGGCCAGCGGCCATAAAAAAGATTCTTGGCCTGGCTCCCATCGCCGTCCAGCAGCTG 60


11963R-3.IR_full       61  AGGAACCTCAATGTCCAGGAACACGTTTCCTACAGTCTGCTCAATGAGGCCAAGATCCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     61  AGGAACCTCAATGTCCAGGAACACGTTTCCTACAGTCTGCTCAATGAGGCCAAGATCCCA 120


11963R-3.IR_full       121 ACACCTCGTTTCGCTGTTGCCAAGAACGGCAAGGAGGCCAACGATATCGCCACCAAGCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     121 ACACCTCGTTTCGCTGTTGCCAAGAACGGCAAGGAGGCCAACGATATCGCCACCAAGCTG 180


11963R-3.IR_full       181 AAGACCGATAACCTGGTGCTGAAGGCTCAGGTTTTGGCCGGAGGACGAGGCAAAGGAACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     181 AAGACCGATAACCTGGTGCTGAAGGCTCAGGTTTTGGCCGGAGGACGAGGCAAAGGAACC 240


11963R-3.IR_full       241 TTTAAGAATGGCCTGAAGGGAGGTGTGCGAGTGGTCTACGATCCCCAGACCGCTGAAGAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     241 TTTAAGAATGGCCTGAAGGGAGGTGTGCGAGTGGTCTACGATCCCCAGACCGCTGAAGAA 300


11963R-3.IR_full       301 CTTTCAAGCAAAATGATTGATCAGCTTCTGGTCACCAAGCAAACCGGAGCAGCCGGTCGC 360
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     301 CTTTCAAGCAAAATGATCGATCAGCTTCTGGTCACCAAGCAAACCGGAGCAGCCGGTCGC 360


11963R-3.IR_full       361 ATCTGCAAAAAGGTGATGGTTGCCGAAAGGAAGTTCCCCCGCCGTGAGTTCTACTTCGCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     361 ATCTGCAAAAAGGTGATGGTTGCCGAAAGGAAGTTCCCCCGCCGTGAGTTCTACTTCGCC 420


11963R-3.IR_full       421 GTGATGATGGAGCGTGCCTTTAACGGTCCCGTGCTGATCGCCTCCAAGGAGGGTGGTGTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11963R-3.in silico     421 GTGATGATGGAGCGTGCCTTTAACGGTCCCGTGCTGATCGCCTCCAAGGAGGGTGGTGTT 480


11963R-3.IR_full       481 GATATTGAGGAGGTGGNTGC 500
                           |||||||||||||||| |||
11963R-3.in silico     481 GATATTGAGGAGGTGGCTGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141589.2  CG11963-RA (CG11963), mRNA 
0   NM_137081.2  CG30483-RA (Prosap), mRNA 
0   NM_165993.1  CG6016-RB, transcript variant B (CG6016), mRNA 
0   NM_137033.2  CG6016-RA, transcript variant A (CG6016), mRNA 
0   NM_079528.2  CG2520-RA (lap), mRNA 
0   NM_057278.3  CG7727-RA (Appl), mRNA 
0   NM_141693.2  CG8507-RA (CG8507), mRNA 
0   NM_164406.1  CG5080-RA, transcript variant A (CG5080), mRNA 
0   NM_134734.2  CG5080-RB, transcript variant B (CG5080), mRNA 
0   NM_137166.3  CG7761-RA (pcs), mRNA 
0   NM_169895.1  CG4342-RA (CG4342), mRNA 
0   NM_136767.2  CG12936-RA (CG12936), mRNA 
0   NM_135537.1  CG5375-RA (CG5375), mRNA 
0   NM_134869.2  CG2964-RA (CG2964), mRNA 
0   NM_135083.2  CG6634-RA (mid), mRNA 
0   NM_143252.2  CG6378-RA (BM-40-SPARC), mRNA 
0   NM_170562.1  CG1815-RA, transcript variant A (CG1815), mRNA 
0   NM_169248.2  CG10901-RA, transcript variant A (osk), mRNA 
0   NM_206464.1  CG10901-RC, transcript variant C (osk), mRNA 
0   NM_170563.1  CG1815-RB, transcript variant B (CG1815), mRNA 
0   NM_143624.2  CG1815-RC, transcript variant C (CG1815), mRNA 
0   NM_132689.2  CG11151-RA (CG11151), mRNA 
0   NM_176715.1  CG7033-RC, transcript variant C (CG7033), mRNA 
0   NM_132296.2  CG7033-RA, transcript variant A (CG7033), mRNA 
0   NM_167176.1  CG7033-RB, transcript variant B (CG7033), mRNA 
0   NM_170051.1  CG31457-RB (CG31457), mRNA 
0   NM_140025.2  CG5187-RA, transcript variant A (Doc2), mRNA 
0   NM_001014578.1  CG5187-RB, transcript variant B (Doc2), mRNA 
0   NM_078705.2  CG1685-RA (pen), mRNA 
0   NM_130672.2  CG2712-RA (CG2712), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.