National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11953R-3 
 Symbol zormin  Full Name zormin 
 CG No CG33484  Old CG No CG11953 
 Synonyms CG5699, CT36990, CG32311, CG32310, CG32307, CG32309, CG11952, CG11953, CG1282, CG11850, CG33484, BcDNA:GH09541, zormin 
 Accession No (Link to NCBI) NM_206240.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTAGACTCATCGATGTCTTC 
 Primer Seq. 3'
aatctagaggtaccTGCGGGGTACAAGAGTACAAC 
 Predicted Fragment Size
332 
 IR fragment full Seq
0001 CCTAGACTCA TCGATGTCTT CGCTCTACTC GGTCGCCTCC TCCTCGAATC CCAATCCCCG 
0061 CCAGCCGCAC ACCGGCCACC AACTTCAGAC GCAGCAATCC CAGCAATCTC AGCAGTCCCA 
0121 GCTAGACGCC TTCAATTATT CAGCAACAAT GTCATCATTC GTCGCCGACT CCAAGTCAGG 
0181 CCATGTCCAC AGCCATGTCC ACGGGCACGG GCACCGGCAC CGGCACCACC CACACCACAC 
0241 CACCAtccTC CTCCTCCCTG AGAGCCACCA CCATTGGCAC CGTTGTCGTC CGATGCGGAC 
0301 CCATCCAGCT GGTGATAGCG CTCCTACAAG TGA 
 in silico PCR Fragment
0001 CCTAGACTCA TCGATGTCTT CGCTCTACTC GGTCGCCTCC TCCTCGAATC CCAATCCCCG 
0061 CCAGCCGCAC ACCGGCCACC AACTTCAGAC GCAGCAATCC CAGCAATCTC AGCAGTCCCA 
0121 GCTAGACGCC TTCAATTATT CAGCAACAAT GTCATCA-TC GTCGCCGACT CCAAGTCAGG 
0181 CCATGTCCAC AGCCATGTCC ACGGGCACGG GCACCGGCAC CGGCACCACC CACACCACAC 
0241 CACCATCCTC CTCCTCCCTG AGAGCCACCA CCATTGGCAC CGTTGTCGTC CGATGCGGAC 
0301 CCATCCAGCT GGTGATAGCG CTCCTACAAG TGA 
 Assemble Data

11953R-3.IR_full       1   CCTAGACTCATCGATGTCTTCGCTCTACTCGGTCGCCTCCTCCTCGAATCCCAATCCCCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11953R-3.in silico     1   CCTAGACTCATCGATGTCTTCGCTCTACTCGGTCGCCTCCTCCTCGAATCCCAATCCCCG 60


11953R-3.IR_full       61  CCAGCCGCACACCGGCCACCAACTTCAGACGCAGCAATCCCAGCAATCTCAGCAGTCCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11953R-3.in silico     61  CCAGCCGCACACCGGCCACCAACTTCAGACGCAGCAATCCCAGCAATCTCAGCAGTCCCA 120


11953R-3.IR_full       121 GCTAGACGCCTTCAATTATTCAGCAACAATGTCATCATTCGTCGCCGACTCCAAGTCAGG 180
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
11953R-3.in silico     121 GCTAGACGCCTTCAATTATTCAGCAACAATGTCATCA-TCGTCGCCGACTCCAAGTCAGG 180


11953R-3.IR_full       181 CCATGTCCACAGCCATGTCCACGGGCACGGGCACCGGCACCGGCACCACCCACACCACAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11953R-3.in silico     181 CCATGTCCACAGCCATGTCCACGGGCACGGGCACCGGCACCGGCACCACCCACACCACAC 240


11953R-3.IR_full       241 CACCATCCTCCTCCTCCCTGAGAGCCACCACCATTGGCACCGTTGTCGTCCGATGCGGAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11953R-3.in silico     241 CACCATCCTCCTCCTCCCTGAGAGCCACCACCATTGGCACCGTTGTCGTCCGATGCGGAC 300


11953R-3.IR_full       301 CCATCCAGCTGGTGATAGCGCTCCTACAAGTGA 333
                           |||||||||||||||||||||||||||||||||
11953R-3.in silico     301 CCATCCAGCTGGTGATAGCGCTCCTACAAGTGA 333

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.