National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11936R-2 
 Symbol CG32529  Full Name CG32529 
 CG No CG32529  Old CG No CG11936 
 Synonyms CG15619, CG11936, CG32529 
 Accession No (Link to NCBI) NM_134516.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGAAGCGGCCCGGGAAACAG 
 Primer Seq. 3'
aatctagaggtaccACTCGCTTTACAGGCGGCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGAAGCGGC CCGGGAAACA GACGAAGGCC TCCGGTGGCG GCGGCGACGA GGCGGATGAC 
0061 AAGAAGTCAG CCAGCAAAAC AGATTCGGCG GCCAAGAAGC CGGCCAAGGA TCCAACGGGA 
0121 TCATCGGGCG TGTCCACAGC CACCACTGAG GGTGGTGCTG GNAAATGGAG GCGGAAAACA 
0181 AACGACCTCC ACCACGACAT CATCCACATC CTCGACAACC GCCCCGTCCG CATCTGCATC 
0241 TGCATCTGCT TCCAACAGCC TTAAATTGTC GCCGGAGGAA CGACACGAGG ATGGCAAGGC 
0301 GCGGGCCATT AACAAGATGC TTAAGAGCCT GGATATCAAG ATCCACGGCT TCGACAACNC 
0361 TGCTGCCTAG CGGCGAAGAG CGGCTCAACG ACGGCGTGCT GAAGTCCTCC ATTTCGGAGA 
0421 ATGTCAAGAC CAAGTcNCGN GCAGCGGCGG TCAAGGTGAT TTCCAGCCTG AATNCCgNCA 
0481 AGATGCCGCC TGTAAAGCGA GT 
 in silico PCR Fragment
0001 AAGAAGCGGC CCGGGAAACA GACGAAGGCC TCCGGTGGCG GCGGCGACGA GGCGGATGAC 
0061 AAGAAGTCAG CCAGCAAAAC AGATTCGGCG GCCAAGAAGC CGGCCAAGGA TCCAACGGGA 
0121 TCATCGGGCG TGTCCACAGC CACCACTGAG GGTGGTGCTG G-AAATGGAG GCGGAAAACA 
0181 AACGACCTCC ACCACGACAT CATCCACATC CTCGACAACC GCCCCGTCCG CATCTGCATC 
0241 TGCATCTGCT TCCAACAGCC TTAAATTGTC GCCGGAGGAA CGACACGAGG ATGGCAAGGC 
0301 GCGGGCCATT AACAAGATGC TTAAGAGCCT GGATATCAAG ATCCACGGCT TCGACAAC-C 
0361 TGCTGCCTAG CGGCGAAGAG CGGCTCAACG ACGGCGTGCT GAAGTCCTCC ATTTCGGAGA 
0421 ATGTCAAGAC CAAGTCGCGC GCAGCGGCGG TCAAGGTGAT TTCCAGCCTG AATCCCGGCA 
0481 AGATGCCGCC TGTAAAGCGA GT 
 Assemble Data

11936R-2.IR_full       1   AAGAAGCGGCCCGGGAAACAGACGAAGGCCTCCGGTGGCGGCGGCGACGAGGCGGATGAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11936R-2.in silico     1   AAGAAGCGGCCCGGGAAACAGACGAAGGCCTCCGGTGGCGGCGGCGACGAGGCGGATGAC 60


11936R-2.IR_full       61  AAGAAGTCAGCCAGCAAAACAGATTCGGCGGCCAAGAAGCCGGCCAAGGATCCAACGGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11936R-2.in silico     61  AAGAAGTCAGCCAGCAAAACAGATTCGGCGGCCAAGAAGCCGGCCAAGGATCCAACGGGA 120


11936R-2.IR_full       121 TCATCGGGCGTGTCCACAGCCACCACTGAGGGTGGTGCTGGNAAATGGAGGCGGAAAACA 180
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
11936R-2.in silico     121 TCATCGGGCGTGTCCACAGCCACCACTGAGGGTGGTGCTGG-AAATGGAGGCGGAAAACA 180


11936R-2.IR_full       181 AACGACCTCCACCACGACATCATCCACATCCTCGACAACCGCCCCGTCCGCATCTGCATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11936R-2.in silico     181 AACGACCTCCACCACGACATCATCCACATCCTCGACAACCGCCCCGTCCGCATCTGCATC 240


11936R-2.IR_full       241 TGCATCTGCTTCCAACAGCCTTAAATTGTCGCCGGAGGAACGACACGAGGATGGCAAGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11936R-2.in silico     241 TGCATCTGCTTCCAACAGCCTTAAATTGTCGCCGGAGGAACGACACGAGGATGGCAAGGC 300


11936R-2.IR_full       301 GCGGGCCATTAACAAGATGCTTAAGAGCCTGGATATCAAGATCCACGGCTTCGACAACNC 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
11936R-2.in silico     301 GCGGGCCATTAACAAGATGCTTAAGAGCCTGGATATCAAGATCCACGGCTTCGACAAC-C 360


11936R-2.IR_full       361 TGCTGCCTAGCGGCGAAGAGCGGCTCAACGACGGCGTGCTGAAGTCCTCCATTTCGGAGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11936R-2.in silico     361 TGCTGCCTAGCGGCGAAGAGCGGCTCAACGACGGCGTGCTGAAGTCCTCCATTTCGGAGA 420


11936R-2.IR_full       421 ATGTCAAGACCAAGTCNCGNGCAGCGGCGGTCAAGGTGATTTCCAGCCTGAATNCCGNCA 480
                           |||||||||||||||| || ||||||||||||||||||||||||||||||||| ||| ||
11936R-2.in silico     421 ATGTCAAGACCAAGTCGCGCGCAGCGGCGGTCAAGGTGATTTCCAGCCTGAATCCCGGCA 480


11936R-2.IR_full       481 AGATGCCGCCTGTAAAGCGAGT 502
                           ||||||||||||||||||||||
11936R-2.in silico     481 AGATGCCGCCTGTAAAGCGAGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  17  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
1.45   14  21  21  NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
1.45   14  21  21  NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
1.45   14  21  21  NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
1.45   14  21  21  NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
1.45   13  14  18  NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
1.45   13  14  18  NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
1.45   12  20  NM_137871.2  CG3536-RA (CG3536), mRNA 
0.41   12  15  NM_139710.1  CG10629-RA (CG10629), mRNA 
0.41   11  NM_168275.1  CG32354-RA (CG32354), mRNA 
0.41   10  NM_140614.2  CG13062-RA (CG13062), mRNA 
0.2   NM_132643.2  CG1764-RA (CG1764), mRNA 
0.2   NM_132858.2  CG9056-RA (CG9056), mRNA 
0.2   11  NM_078649.2  CG9842-RA (Pp2B-14D), mRNA 
0   11  NM_137376.1  CG14479-RA (CG14479), mRNA 
0   13  14  NM_166452.1  CG9847-RB, transcript variant B (Fkbp13), mRNA 
0   13  14  NM_057625.3  CG9847-RA, transcript variant A (Fkbp13), mRNA 
0   12  17  NM_167571.1  CG12991-RB, transcript variant B (CG12991), mRNA 
0   12  17  NM_132995.1  CG12991-RA, transcript variant A (CG12991), mRNA 
0   NM_165773.2  CG2204-RC, transcript variant C (G-oalpha47A), mRNA 
0   NM_078960.4  CG2204-RA, transcript variant A (G-oalpha47A), mRNA 
0   NM_206079.1  CG2204-RI, transcript variant I (G-oalpha47A), mRNA 
0   NM_176126.2  CG2204-RF, transcript variant F (G-oalpha47A), mRNA 
0   NM_176127.2  CG2204-RG, transcript variant G (G-oalpha47A), mRNA 
0   NM_206080.1  CG2204-RH, transcript variant H (G-oalpha47A), mRNA 
0   NM_165772.3  CG2204-RB, transcript variant B (G-oalpha47A), mRNA 
0   NM_176124.2  CG2204-RD, transcript variant D (G-oalpha47A), mRNA 
0   NM_176125.2  CG2204-RE, transcript variant E (G-oalpha47A), mRNA 
0   13  24  NM_143393.1  CG14520-RA (CG14520), mRNA 
0   10  NM_001038901.1  CG34047-RA (CG34047), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.