National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11866Ra-2 
 Symbol dmpd  Full Name dampened 
 CG No CG11866  Old CG No CG11866 
 Synonyms CG11866,dmpd,FBXO13,dampened 
 Accession No (Link to NCBI) NM_136711.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCGGAGGGGGTTTCGCCGTT 
 Primer Seq. 3'
aatctagaggtaccTGCTGGCCTTGATCGCCTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCGGAGGGG GTTTCGCCGT TCGGGGGCGC GGGTTCGGGA TCGGCCTCTG GAACGGGAAT 
0061 GGCTTCCGGA TCAGCAGTGT CATCCGGATC GGGTACTGGA GTACAAGAGC CCCCCGAGTC 
0121 CACAGCAAAC CGTTCCTCCG TCCTGCGGCG AACCACCAGC TATCAGGGTA ACCAGGCCCA 
0181 CAGTTCTTAT CGTGTCGTCT CGGCGGGCAG CCTGGCCGAG TCCGCCAGTG CGGTGACTCG 
0241 CCTCCACTCG TACACCATGC AGATGCAACG GCAGCGTCCA CCGACTGCCA CCACCACCAC 
0301 CACCACCAGC GCACCCAGTC TGTACGATCT TCCCAACGAG CTGATTGAGA AGATCCTCAG 
0361 CTACGTGGAC TACAAGAAAG TTTCAAATCT CAGATTGGTT TCGCACCGCA TGAACGACAT 
0421 TTGCATGGCC ATGCTGAACA CAGCCTTCAC CAAGCAGATC AAGACCACAT TGAGCCGCTT 
0481 CCAGGCGATC AAGGCCAGCA  
 in silico PCR Fragment
0001 TTCGGAGGGG GTTTCGCCGT TCGGGGGCGC GGGTTCGGGA TCGGCCTCTG GAACGGGAAT 
0061 GGCTTCCGGA TCAGCAGTGT CATCCGGATC GGGTACTGGA GTACAAGAGC CCCCCGAGTC 
0121 CACAGCAAAC CGTTCCTCCG TCCTGCGGCG AACCACCAGC TATCAGGGTA ACCAGGCCCA 
0181 CAGTTCTTAT CGTGTCGTCT CGGCGGGCAG CCTGGCCGAG TCCGCCAGTG CGGTG-ACTC 
0241 GCCTCCACTC GTACACCATG CAGATGCAAC GGCAGCGTCC ACCGACGG-- ----CCACCA 
0301 CCACCACCAC CACCAGCGCA CCCAGTCTGT ACGATCTTCC CAACGAGCTG ATTGAGAAGA 
0361 TCCTCAGCTA CGTGGACTAC AAGAAAGTTT CAAATCTCAG ATTGGTTTCG CACCGCATGA 
0421 ACGACATTTG CATGGCCATG CTGAACACAG CCTTCACCAA GCAGATCAAG ACCACATTGA 
0481 GCCGCTTCCA GGCGATCAAG GCCAGCA 
 Assemble Data

11866Ra-2.IR full       1   TTCGGAGGGGGTTTCGCCGTTCGGGGGCGCGGGTTCGGGATCGGCCTCTGGAACGGGAAT 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11866Ra-2.in silico     1   TTCGGAGGGGGTTTCGCCGTTCGGGGGCGCGGGTTCGGGATCGGCCTCTGGAACGGGAAT 60


11866Ra-2.IR full       61  GGCTTCCGGATCAGCAGTGTCATCCGGATCGGGTACTGGAGTACAAGAGCCCCCCGAGTC 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11866Ra-2.in silico     61  GGCTTCCGGATCAGCAGTGTCATCCGGATCGGGTACTGGAGTACAAGAGCCCCCCGAGTC 120


11866Ra-2.IR full       121 CACAGCAAACCGTTCCTCCGTCCTGCGGCGAACCACCAGCTATCAGGGTAACCAGGCCCA 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11866Ra-2.in silico     121 CACAGCAAACCGTTCCTCCGTCCTGCGGCGAACCACCAGCTATCAGGGTAACCAGGCCCA 180


11866Ra-2.IR full       181 CAGTTCTTATCGTGTCGTCTCGGCGGGCAGCCTGGCCGAGTCCGCCAGTGCGGTGACTCG 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11866Ra-2.in silico     181 CAGTTCTTATCGTGTCGTCTCGGCGGGCAGCCTGGCCGAGTCCGCCAGTGCGGTGACTCG 240


11866Ra-2.IR full       241 CCTCCACTCGTACACCATGCAGATGCAACGGCAGCGTCCACCGACTGCCACCACCACCAC 300
                            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
11866Ra-2.in silico     241 CCTCCACTCGTACACCATGCAGATGCAACGGCAGCGTCCACCGACGGCCACCACCACCAC 300


11866Ra-2.IR full       301 CACCACCAGCGCACCCAGTCTGTACGATCTTCCCAACGAGCTGATTGAGAAGATCCTCAG 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11866Ra-2.in silico     301 CACCACCAGCGCACCCAGTCTGTACGATCTTCCCAACGAGCTGATTGAGAAGATCCTCAG 360


11866Ra-2.IR full       361 CTACGTGGACTACAAGAAAGTTTCAAATCTCAGATTGGTTTCGCACCGCATGAACGACAT 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11866Ra-2.in silico     361 CTACGTGGACTACAAGAAAGTTTCAAATCTCAGATTGGTTTCGCACCGCATGAACGACAT 420


11866Ra-2.IR full       421 TTGCATGGCCATGCTGAACACAGCCTTCACCAAGCAGATCAAGACCACATTGAGCCGCTT 480
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11866Ra-2.in silico     421 TTGCATGGCCATGCTGAACACAGCCTTCACCAAGCAGATCAAGACCACATTGAGCCGCTT 480


11866Ra-2.IR full       481 CCAGGCGATCAAGGCCAGCA 500
                            ||||||||||||||||||||
11866Ra-2.in silico     481 CCAGGCGATCAAGGCCAGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  20  NM_136711.2  CG11866-RA (CG11866), mRNA 
3.11   15  18  33  35  NM_132391.2  CG15307-RA (CG15307), mRNA 
2.9   14  25  42  45  NM_132214.1  CG15335-RB (CG15335), mRNA 
2.28   11  20  31  44  NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
2.28   11  14  25  36  NM_206663.1  CG12075-RB, transcript variant B (CG12075), mRNA 
2.28   11  14  25  36  NM_132278.2  CG12075-RA, transcript variant A (CG12075), mRNA 
2.07   10  26  46  61  NM_140417.2  CG17364-RA, transcript variant A (CG17364), mRNA 
2.07   10  26  46  61  NM_176328.1  CG17364-RB, transcript variant B (CG17364), mRNA 
2.07   10  15  41  80  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
1.86   18  33  44  NM_001038911.1  CG34050-RA (CG34050), mRNA 
1.86   14  23  24  NM_143633.1  CG2187-RA (CG2187), mRNA 
1.65   18  28  42  NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
1.65   18  28  42  NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
1.65   18  28  42  NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
1.65   18  28  41  NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
1.65   16  24  34  NM_132009.2  CG11473-RA (CG11473), mRNA 
1.65   14  24  29  NM_078869.4  CG15154-RB, transcript variant B (Socs36E), mRNA 
1.65   14  24  29  NM_165243.1  CG15154-RA, transcript variant A (Socs36E), mRNA 
1.45   18  27  43  NM_135952.1  CG5953-RA, transcript variant A (CG5953), mRNA 
1.45   18  27  43  NM_165165.1  CG5953-RB, transcript variant B (CG5953), mRNA 
1.45   15  26  28  NM_139478.1  CG1143-RA (CG1143), mRNA 
1.45   13  26  25  NM_079148.2  CG6883-RA, transcript variant A (trh), mRNA 
1.45   13  26  25  NM_001043110.1  CG6883-RB, transcript variant B (trh), mRNA 
1.45   12  18  24  NM_130497.2  CG13363-RA (Suv4-20), mRNA 
1.45   12  17  21  NM_206407.1  CG32434-RA, transcript variant A (siz), mRNA 
1.24   27  61  90  NM_137672.1  CG15225-RA (CG15225), mRNA 
1.24   14  33  51  NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
1.24   13  26  29  NM_057309.2  CG6534-RA (slou), mRNA 
1.24   13  23  39  NM_137510.2  CG30122-RB (CG30122), mRNA 
1.24   11  23  25  NM_143571.2  CG15544-RA (CG15544), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.