National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11865Ra-4 
 Symbol CG11865  Full Name CG11865 
 CG No CG11865  Old CG No CG11865 
 Synonyms BACR44L22.4, BG:BACR44L22.4, CG11865 
 Accession No (Link to NCBI) NM_135915.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGGAAGAACGTTGGTCTACA 
 Primer Seq. 3'
aatctagaggtaccCTGACCGATTTTCGCATGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NNNNNAGAAC GTTGGTCTAC AGTTATGNCG GAGGATTTTC TTCCTTGGAT ATTGCAAGTA 
0061 TTGAAAGTGC CATGGCAGAA ATATCATCGA AAACCTGTGT GAAATTTCGC CGAACGGAAT 
0121 ACAAGAGGGA GCTACAAGTA GTTATACAAA AAGAGGGTTC AGGATGCTGG TCGTATGTAG 
0181 GATATTTGGG AAGAGCAGAC CAGGCCCTCA ATCTAGGCAG TGGTTGTATG TCCAGGAGGA 
0241 CTATTCAGCA TGAACTTCTT CACGCCTTAG GCTTCTTTCA CACACACAGC GATCCGCAGC 
0301 GGGATAAATA TGTGAGGATC CAAACCGATA ACATCAGATC CGGTCATGAA CATAACTTTC 
0361 AAAGGCTTCG TGCCAATGGA GTGACAAATT ATGGCCTTGG CTACGACTAC GACAGCATNA 
0421 TGCACTATGG TCCATTTGCT TTCTCCAAGA ACGGACAGTC GACAATTGTT CCTTTGANAT 
0481 CNCATGCGNA AATCGGTCAG  
 in silico PCR Fragment
0001 AGGGAAGAAC GTTGGTCTAC AGTTATGCCG GAGGATTTTC TTCCTTGGAT ATTGCAAGTA 
0061 TTGAAAGTGC AATGGCAGAA ATATCATCGA AAACCTGTGT GAAATTTCGC CGAACGGAAT 
0121 ACAAGAGGGA GCCACAAGTA GTTATACAAA AAGAGGGTTC AGGATGCTGG TCGTATGTAG 
0181 GATATTTGGG AAGAGCAGAC CAGACCCTCA ATCTAGGCAG TGGTTGTATG TCCAATAGGA 
0241 CTATTCAGCA TGAACTTCTT CACGCCTTAG GCTTCTTTCA CACACACAGC GATCCGCAGC 
0301 GGGATAAATA TGTGAGGATC CAAACCGATA ACATCAGATC CGGTCATGAA CATAACTTTC 
0361 AAAGGCTTCG TGCCAATGGA GTGACAAATT ATGGATTTGG CTACGACTAC GACAGCATTA 
0421 TGCACTATGG TCCATTTGCT TTCTCCAAGA ACGGACAGTC GACAATTGTT CCTTTGAAAT 
0481 CCCATGCGAA AATCGGTCAG  
 Assemble Data

11865Ra-4.IR full        NNNN1   AGAACGTTGGTCTACAGTTATGNCGGAGGATTTTCTTCCTTGGATATTGCAAGTA 55
                                 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||
11865Ra-4.in silico      AGGG1   AGAACGTTGGTCTACAGTTATGCCGGAGGATTTTCTTCCTTGGATATTGCAAGTA 55


11865Ra-4.IR full       61  TTGAAAGTGCCATGGCAGAAATATCATCGAAAACCTGTGTGAAATTTCGCCGAACGGAAT 115
                            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
11865Ra-4.in silico     61  TTGAAAGTGCAATGGCAGAAATATCATCGAAAACCTGTGTGAAATTTCGCCGAACGGAAT 115


11865Ra-4.IR full       121 ACAAGAGGGAGCTACAAGTAGTTATACAAAAAGAGGGTTCAGGATGCTGGTCGTATGTAG 175
                            |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
11865Ra-4.in silico     121 ACAAGAGGGAGCCACAAGTAGTTATACAAAAAGAGGGTTCAGGATGCTGGTCGTATGTAG 175


11865Ra-4.IR full       181 GATATTTGGGAAGAGCAGACCAGGCCCTCAATCTAGGCAGTGGTTGTATGTCCAGGAGGA 235
                            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||  ||||
11865Ra-4.in silico     181 GATATTTGGGAAGAGCAGACCAGACCCTCAATCTAGGCAGTGGTTGTATGTCCAATAGGA 235


11865Ra-4.IR full       241 CTATTCAGCATGAACTTCTTCACGCCTTAGGCTTCTTTCACACACACAGCGATCCGCAGC 295
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11865Ra-4.in silico     241 CTATTCAGCATGAACTTCTTCACGCCTTAGGCTTCTTTCACACACACAGCGATCCGCAGC 295


11865Ra-4.IR full       301 GGGATAAATATGTGAGGATCCAAACCGATAACATCAGATCCGGTCATGAACATAACTTTC 355
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11865Ra-4.in silico     301 GGGATAAATATGTGAGGATCCAAACCGATAACATCAGATCCGGTCATGAACATAACTTTC 355


11865Ra-4.IR full       361 AAAGGCTTCGTGCCAATGGAGTGACAAATTATGGCCTTGGCTACGACTACGACAGCATNA 415
                            ||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| |
11865Ra-4.in silico     361 AAAGGCTTCGTGCCAATGGAGTGACAAATTATGGATTTGGCTACGACTACGACAGCATTA 415


11865Ra-4.IR full       421 TGCACTATGGTCCATTTGCTTTCTCCAAGAACGGACAGTCGACAATTGTTCCTTTGANAT 475
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
11865Ra-4.in silico     421 TGCACTATGGTCCATTTGCTTTCTCCAAGAACGGACAGTCGACAATTGTTCCTTTGAAAT 475


11865Ra-4.IR full       481 CNCATGCGNAAATCGGTCAG 495
                            | |||||| |||||||||||
11865Ra-4.in silico     481 CCCATGCGAAAATCGGTCAG 495

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135915.1  CG11865-RA (CG11865), mRNA 
0.41   NM_134503.2  CG14231-RA (CG14231), mRNA 
0   NM_130675.1  CG14416-RA (CG14416), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_001038865.1  CG33981-RA, transcript variant A (CG33981), mRNA 
0   NM_001038866.1  CG33981-RB, transcript variant B (CG33981), mRNA 
0   NM_206158.1  CG6355-RB, transcript variant B (CG6355), mRNA 
0   NM_137425.3  CG6355-RA, transcript variant A (CG6355), mRNA 
0   NM_206514.1  CG14307-RK, transcript variant K (fru), mRNA 
0   NM_137277.2  CG7989-RA (l(2)k07824), mRNA 
0   NM_001038988.2  CG34041-RA (CG34041), mRNA 
0   NM_057866.2  CG10800-RA (Rca1), mRNA 
0   NM_136474.2  CG1942-RA (CG1942), mRNA 
0   NM_206490.1  CG3631-RC, transcript variant C (CG3631), mRNA 
0   NM_169605.1  CG3631-RB, transcript variant B (CG3631), mRNA 
0   NM_142141.2  CG3631-RA, transcript variant A (CG3631), mRNA 
0   NM_135914.1  CG15253-RA (CG15253), mRNA 
0   NM_176201.1  CG4905-RE, transcript variant E (Syn2), mRNA 
0   NM_079038.3  CG4905-RC, transcript variant C (Syn2), mRNA 
0   NM_166180.2  CG4905-RB, transcript variant B (Syn2), mRNA 
0   NM_166181.2  CG4905-RD, transcript variant D (Syn2), mRNA 
0   NM_166179.2  CG4905-RA, transcript variant A (Syn2), mRNA 
0   NM_142157.1  CG6974-RA (CG6974), mRNA 
0   NM_142337.1  CG3962-RA, transcript variant A (Keap1), mRNA 
0   NM_176508.1  CG3962-RC, transcript variant C (Keap1), mRNA 
0   NM_169744.1  CG3962-RB, transcript variant B (Keap1), mRNA 
0   NM_166266.1  CG5119-RD, transcript variant D (pAbp), mRNA 
0   NM_166264.1  CG5119-RB, transcript variant B (pAbp), mRNA 
0   NM_166268.2  CG5119-RF, transcript variant F (pAbp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.