National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11865Ra-2 
 Symbol CG11865  Full Name CG11865 
 CG No CG11865  Old CG No CG11865 
 Synonyms BACR44L22.4, BG:BACR44L22.4, CG11865 
 Accession No (Link to NCBI) NM_135915.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                                 |||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico      AGGG1   AGAACGTTGGTCTACAGTTATGCCGGAGGATTTTCTTCCTTGGATATTGCAAGTA 55

                            |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTGAAAGTGCAATGGCAGAAATATCATCGAAAACCTGTGTGAAATTTCGCCGAACGGAAT 115

                            |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACAAGAGGGAGCCACAAGTAGTTATACAAAAAGAGGGTTCAGGATGCTGGTCGTATGTAG 175

                            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||  |||| silico     181 GATATTTGGGAAGAGCAGACCAGACCCTCAATCTAGGCAGTGGTTGTATGTCCAATAGGA 235

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTATTCAGCATGAACTTCTTCACGCCTTAGGCTTCTTTCACACACACAGCGATCCGCAGC 295

                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGATAAATATGTGAGGATCCAAACCGATAACATCAGATCCGGTCATGAACATAACTTTC 355

                            ||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| | silico     361 AAAGGCTTCGTGCCAATGGAGTGACAAATTATGGATTTGGCTACGACTACGACAGCATTA 415

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     421 TGCACTATGGTCCATTTGCTTTCTCCAAGAACGGACAGTCGACAATTGTTCCTTTGAAAT 475

11865Ra-2.IR full       481 CNCATGCGNAAATCGGTCAG 495
                            | |||||| ||||||||||| silico     481 CCCATGCGAAAATCGGTCAG 495

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135915.1  CG11865-RA (CG11865), mRNA 
0.41   NM_134503.2  CG14231-RA (CG14231), mRNA 
0   NM_130675.1  CG14416-RA (CG14416), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_001038865.1  CG33981-RA, transcript variant A (CG33981), mRNA 
0   NM_001038866.1  CG33981-RB, transcript variant B (CG33981), mRNA 
0   NM_206158.1  CG6355-RB, transcript variant B (CG6355), mRNA 
0   NM_137425.3  CG6355-RA, transcript variant A (CG6355), mRNA 
0   NM_206514.1  CG14307-RK, transcript variant K (fru), mRNA 
0   NM_137277.2  CG7989-RA (l(2)k07824), mRNA 
0   NM_001038988.2  CG34041-RA (CG34041), mRNA 
0   NM_057866.2  CG10800-RA (Rca1), mRNA 
0   NM_136474.2  CG1942-RA (CG1942), mRNA 
0   NM_206490.1  CG3631-RC, transcript variant C (CG3631), mRNA 
0   NM_169605.1  CG3631-RB, transcript variant B (CG3631), mRNA 
0   NM_142141.2  CG3631-RA, transcript variant A (CG3631), mRNA 
0   NM_135914.1  CG15253-RA (CG15253), mRNA 
0   NM_176201.1  CG4905-RE, transcript variant E (Syn2), mRNA 
0   NM_079038.3  CG4905-RC, transcript variant C (Syn2), mRNA 
0   NM_166180.2  CG4905-RB, transcript variant B (Syn2), mRNA 
0   NM_166181.2  CG4905-RD, transcript variant D (Syn2), mRNA 
0   NM_166179.2  CG4905-RA, transcript variant A (Syn2), mRNA 
0   NM_142157.1  CG6974-RA (CG6974), mRNA 
0   NM_142337.1  CG3962-RA, transcript variant A (Keap1), mRNA 
0   NM_176508.1  CG3962-RC, transcript variant C (Keap1), mRNA 
0   NM_169744.1  CG3962-RB, transcript variant B (Keap1), mRNA 
0   NM_166266.1  CG5119-RD, transcript variant D (pAbp), mRNA 
0   NM_166264.1  CG5119-RB, transcript variant B (pAbp), mRNA 
0   NM_166268.2  CG5119-RF, transcript variant F (pAbp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.