National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11811R-7 
 Symbol CG11811  Full Name CG11811 
 CG No CG11811  Old CG No CG11811 
 Synonyms CG11811 
 Accession No (Link to NCBI) NM_140151.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTAAATCGGGCGCTCAGCAG 
 Primer Seq. 3'
aatctagaggtaccCCTCCGTTTCGGAGCCACGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTAAATCGG GCGCTCAgNA GCAGCAGCAG CAGTAGCAGT GCAGCGGCAT CCTTAACGAG 
0061 CAAGAAGATG ACCGCCCCCG GGCCACGCCC CCTTGTCCTA TGCGGTCCCT CGGGATCCGG 
0121 AAAGAGTACG CTGCTGAAAA GGCTATTCGC CGAATTCCCC AGCACCTTTG GCTTCAGCNA 
0181 TATCGCACAC CACGCGGAAG CCGCGTGAGG GCGAGNGAGC NATGGCGTGC ACTACTATTT 
0241 TGTGGAACGT CCGGAAATGG AGGCAGCCAT CGCTGGCGAC GAGTTCATCG AGACGGCCGA 
0301 GTTTACGGGC AATCTTTATG GAACGAGCAA GGCGGCGGTT AGAGAGATCC AGGCACAGGG 
0361 ACGGGTCTGC ATACTGGACA TCGAACAGAA GGGAGTGGAG CAGATCAAGC GTACGGATCT 
0421 CAATCCCATA CTGATATTCA ACAATCCACC GAGCATCAAG GAGCTGGAGC GACGACTTTC 
0481 GCAAACGTGG CtCCGAAACG GAGG 
 in silico PCR Fragment
0001 TGTAAATCGG GCGCTCAGCA GCAGCAGCAG CAGTAGCAGT GCAGCGGCAT CCTTAACGAG 
0061 CAAGAAGATG ACCGCCCCCG GGCCACGCCC CCTTGTCCTA TGCGGTCCCT CGGGATCCGG 
0121 AAAGAGTACG CTGCTGAAAA GGCTATTCGC CGAATTCCCC AGCACCTTTG GCTTCAGC-A 
0181 TATCGCACAC CACGCGGAAG CCGCGTGAGG GCGAG-GAGC -ATGGCGTGC ACTACTATTT 
0241 TGTGGAACGT CCGGAAATGG AGGCAGCCAT CGCTGGCGAC GAGTTCATCG AGACGGCCGA 
0301 GTTTACGGGC AATCTTTATG GAACGAGCAA GGCGGCGGTT AGAGAGATCC AGGCACAGGG 
0361 ACGGGTCTGC ATACTGGACA TCGAACAGAA GGGAGTGGAG CAGATCAAGC GTACGGATCT 
0421 CAATCCCATA CTGATATTCA ACAATCCACC GAGCATCAAG GAGCTGGAGC GACGAC-TTC 
0481 GCAAACGTGG CTCCGAAACG GAGG 
 Assemble Data

11811R-7.IR_full       1   TGTAAATCGGGCGCTCAGNAGCAGCAGCAGCAGTAGCAGTGCAGCGGCATCCTTAACGAG 60
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
11811R-7.in silico     1   TGTAAATCGGGCGCTCAGCAGCAGCAGCAGCAGTAGCAGTGCAGCGGCATCCTTAACGAG 60


11811R-7.IR_full       61  CAAGAAGATGACCGCCCCCGGGCCACGCCCCCTTGTCCTATGCGGTCCCTCGGGATCCGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11811R-7.in silico     61  CAAGAAGATGACCGCCCCCGGGCCACGCCCCCTTGTCCTATGCGGTCCCTCGGGATCCGG 120


11811R-7.IR_full       121 AAAGAGTACGCTGCTGAAAAGGCTATTCGCCGAATTCCCCAGCACCTTTGGCTTCAGCNA 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
11811R-7.in silico     121 AAAGAGTACGCTGCTGAAAAGGCTATTCGCCGAATTCCCCAGCACCTTTGGCTTCAGC-A 180


11811R-7.IR_full       181 TATCGCACACCACGCGGAAGCCGCGTGAGGGCGAGNGAGCNATGGCGTGCACTACTATTT 240
                           ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||
11811R-7.in silico     181 TATCGCACACCACGCGGAAGCCGCGTGAGGGCGAG-GAGC-ATGGCGTGCACTACTATTT 240


11811R-7.IR_full       241 TGTGGAACGTCCGGAAATGGAGGCAGCCATCGCTGGCGACGAGTTCATCGAGACGGCCGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11811R-7.in silico     241 TGTGGAACGTCCGGAAATGGAGGCAGCCATCGCTGGCGACGAGTTCATCGAGACGGCCGA 300


11811R-7.IR_full       301 GTTTACGGGCAATCTTTATGGAACGAGCAAGGCGGCGGTTAGAGAGATCCAGGCACAGGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11811R-7.in silico     301 GTTTACGGGCAATCTTTATGGAACGAGCAAGGCGGCGGTTAGAGAGATCCAGGCACAGGG 360


11811R-7.IR_full       361 ACGGGTCTGCATACTGGACATCGAACAGAAGGGAGTGGAGCAGATCAAGCGTACGGATCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11811R-7.in silico     361 ACGGGTCTGCATACTGGACATCGAACAGAAGGGAGTGGAGCAGATCAAGCGTACGGATCT 420


11811R-7.IR_full       421 CAATCCCATACTGATATTCAACAATCCACCGAGCATCAAGGAGCTGGAGCGACGACTTTC 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
11811R-7.in silico     421 CAATCCCATACTGATATTCAACAATCCACCGAGCATCAAGGAGCTGGAGCGACGAC-TTC 480


11811R-7.IR_full       481 GCAAACGTGGCTCCGAAACGGAGG 504
                           ||||||||||||||||||||||||
11811R-7.in silico     481 GCAAACGTGGCTCCGAAACGGAGG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_140151.2  CG11811-RA (CG11811), mRNA 
1.45   30  48  67  NM_169851.1  CG31475-RA (CG31475), mRNA 
1.24   14  31  30  NM_058028.3  CG4585-RA (CG4585), mRNA 
1.03   29  63  132  NM_141639.1  CG16779-RA (CG16779), mRNA 
1.03   59  147  NM_136647.2  CG8809-RA (Camta), mRNA 
0.82   23  NM_079905.2  CG12127-RA (amx), mRNA 
0.82   36  59  NM_206458.2  CG17816-RD, transcript variant D (CG17816), mRNA 
0.82   36  59  NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 
0.82   36  59  NM_169198.1  CG17816-RB, transcript variant B (CG17816), mRNA 
0.82   36  59  NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0.62   33  80  150  NM_143765.2  CG12218-RA (mei-P26), mRNA 
0.62   30  76  153  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
0.62   30  76  153  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
0.62   23  114  150  NM_134763.1  CG14351-RA (CG14351), mRNA 
0.62   20  51  74  NM_132420.2  CG32676-RA (CG32676), mRNA 
0.62   13  53  143  NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0.62   12  18  55  NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0.62   12  18  52  NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 
0.62   15  21  NM_165979.1  CG32843-RA (CG32843), mRNA 
0.62   14  NM_132125.1  CG4536-RA (CG4536), mRNA 
0.62   56  62  NM_164960.1  CG32830-RA (CG32830), mRNA 
0.62   45  NM_144311.1  CG15494-RA (CG15494), mRNA 
0.62   27  33  NM_130646.2  CG14045-RA (CG14045), mRNA 
0.62   12  26  NM_134892.2  CG17264-RA (CG17264), mRNA 
0.62   13  30  NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0.62   12  25  NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0.41   37  49  117  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0.41   36  109  180  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0.41   36  109  180  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0.41   35  23  36  NM_130512.2  CG11663-RA (CG11663), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.