National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11811R-3 
 Symbol CG11811  Full Name CG11811 
 CG No CG11811  Old CG No CG11811 
 Synonyms CG11811 
 Accession No (Link to NCBI) NM_140151.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     1   TGTAAATCGGGCGCTCAGCAGCAGCAGCAGCAGTAGCAGTGCAGCGGCATCCTTAACGAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAAGAAGATGACCGCCCCCGGGCCACGCCCCCTTGTCCTATGCGGTCCCTCGGGATCCGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     121 AAAGAGTACGCTGCTGAAAAGGCTATTCGCCGAATTCCCCAGCACCTTTGGCTTCAGC-A 180

                           ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| silico     181 TATCGCACACCACGCGGAAGCCGCGTGAGGGCGAG-GAGC-ATGGCGTGCACTACTATTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGTGGAACGTCCGGAAATGGAGGCAGCCATCGCTGGCGACGAGTTCATCGAGACGGCCGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTTTACGGGCAATCTTTATGGAACGAGCAAGGCGGCGGTTAGAGAGATCCAGGCACAGGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACGGGTCTGCATACTGGACATCGAACAGAAGGGAGTGGAGCAGATCAAGCGTACGGATCT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     421 CAATCCCATACTGATATTCAACAATCCACCGAGCATCAAGGAGCTGGAGCGACGAC-TTC 480

11811R-3.IR_full       481 GCAAACGTGGCTCCGAAACGGAGG 504
                           |||||||||||||||||||||||| silico     481 GCAAACGTGGCTCCGAAACGGAGG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_140151.2  CG11811-RA (CG11811), mRNA 
1.45   30  48  67  NM_169851.1  CG31475-RA (CG31475), mRNA 
1.24   14  31  30  NM_058028.3  CG4585-RA (CG4585), mRNA 
1.03   29  63  132  NM_141639.1  CG16779-RA (CG16779), mRNA 
1.03   59  147  NM_136647.2  CG8809-RA (Camta), mRNA 
0.82   23  NM_079905.2  CG12127-RA (amx), mRNA 
0.82   36  59  NM_206458.2  CG17816-RD, transcript variant D (CG17816), mRNA 
0.82   36  59  NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 
0.82   36  59  NM_169198.1  CG17816-RB, transcript variant B (CG17816), mRNA 
0.82   36  59  NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0.62   33  80  150  NM_143765.2  CG12218-RA (mei-P26), mRNA 
0.62   30  76  153  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
0.62   30  76  153  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
0.62   23  114  150  NM_134763.1  CG14351-RA (CG14351), mRNA 
0.62   20  51  74  NM_132420.2  CG32676-RA (CG32676), mRNA 
0.62   13  53  143  NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0.62   12  18  55  NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0.62   12  18  52  NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 
0.62   15  21  NM_165979.1  CG32843-RA (CG32843), mRNA 
0.62   14  NM_132125.1  CG4536-RA (CG4536), mRNA 
0.62   56  62  NM_164960.1  CG32830-RA (CG32830), mRNA 
0.62   45  NM_144311.1  CG15494-RA (CG15494), mRNA 
0.62   27  33  NM_130646.2  CG14045-RA (CG14045), mRNA 
0.62   12  26  NM_134892.2  CG17264-RA (CG17264), mRNA 
0.62   13  30  NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0.62   12  25  NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0.41   37  49  117  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0.41   36  109  180  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0.41   36  109  180  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0.41   35  23  36  NM_130512.2  CG11663-RA (CG11663), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.