National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11759R-2 
 Symbol Kap3  Full Name Kinesin associated protein 3 
 CG No CG11759  Old CG No CG11759 
 Synonyms CG11759, DmKap, KAP3, Kap, DmKAP, dKAP3, Kap3, Kinesin associated protein 3, Kinesin II accessory protein 
 Accession No (Link to NCBI) NM_167278.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCCGTTCGCTGAACGCCAA 
 Primer Seq. 3'
aatctagaggtaccCCTCGCGCAGAACACGTGACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCCGTTCG CTGAACGCCA AAACGGATCC GGCTGCCTTG GCACGAGAAG TGGTGGAGAA 
0061 GTGTGATCTC ATCCACAAGT CCCAGCTGAA TGACGTCGAG CAGATAATCT TCTATCTGAA 
0121 GAATCGCAAG GATAATGCCA GCAATGATAT ACCGGATAAC AACACTCACA GCCGGCGATC 
0181 GNGCGGNGCT GCACACCTCG CACACNCCGC TCCTCTGCTC GATCGCACAG CAGTGTGGCG 
0241 GCCATGACCA GCAGCACCGG CAGCGGCGGA GGATCCACTG GAGCTAGCAA TGGTGCCTCG 
0301 AATGCCCTGA GTGCCGCCAC GCCCACGGCG GATGTGTCCA TAAACAATAT CGATGAATAT 
0361 GTGGAGCTGC TGTACGAGGA GCTGGGCGAA CGCATTCGAG GCTCGGCCAT GATCCTACAG 
0421 ATGGCGCGAA ATCCCGATAA TCTTGAAGAG CTGGAAAAGA ATGAAGCCTG CCTCAGCGCC 
0481 TTGTCACGTG TTCTGCGCGA GG 
 in silico PCR Fragment
0001 ACTCCGTTCG CTGAACGCCA AAACGGATCC GGCTGCCTTG GCACGAGAAG TGGTGGAGAA 
0061 GTGCGATCTC ATCCACAAGT CCCAGCTTAA TGACGTCGAG CAGATAATCT TTTATCTGAA 
0121 GAATCGCAAG GATAATGCAA GCAATGATAT ACCGGATAAC AACACTCACA GCCGGCGATC 
0181 G-GCGGCGCT GCACACTTCG CACAC-CCGC TCCTCTGCTC GATCGCACAG CAGTGTGGCG 
0241 GCCATGACCA GCAGCACCGG CAGCGGCGGA GGATCCACTG GAGCTAGCAA TGGTGTCTCG 
0301 AATGCCCTGA GTGCCGCCAC GCCCACGGCG GATGTGTCCA TAAACAATAT CGATGAGTAT 
0361 GTGGAGCTGC TGTACGAGGA GCTGGGCGAA CGCATTCGAG GCTCGGCCAT GATCCTACAG 
0421 ATGGCGCGAA ATCCCGATAA TCTTGAAGAG CTGGAAAAGA ATGAAGCCTG CCTCAGCGCC 
0481 TTGTCACGTG TTCTGCGCGA GG 
 Assemble Data

11759R-2.IR_full       1   ACTCCGTTCGCTGAACGCCAAAACGGATCCGGCTGCCTTGGCACGAGAAGTGGTGGAGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11759R-2.in silico     1   ACTCCGTTCGCTGAACGCCAAAACGGATCCGGCTGCCTTGGCACGAGAAGTGGTGGAGAA 60


11759R-2.IR_full       61  GTGTGATCTCATCCACAAGTCCCAGCTGAATGACGTCGAGCAGATAATCTTCTATCTGAA 120
                           ||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||
11759R-2.in silico     61  GTGCGATCTCATCCACAAGTCCCAGCTTAATGACGTCGAGCAGATAATCTTTTATCTGAA 120


11759R-2.IR_full       121 GAATCGCAAGGATAATGCCAGCAATGATATACCGGATAACAACACTCACAGCCGGCGATC 180
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
11759R-2.in silico     121 GAATCGCAAGGATAATGCAAGCAATGATATACCGGATAACAACACTCACAGCCGGCGATC 180


11759R-2.IR_full       181 GNGCGGNGCTGCACACCTCGCACACNCCGCTCCTCTGCTCGATCGCACAGCAGTGTGGCG 240
                           | |||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||
11759R-2.in silico     181 G-GCGGCGCTGCACACTTCGCACAC-CCGCTCCTCTGCTCGATCGCACAGCAGTGTGGCG 240


11759R-2.IR_full       241 GCCATGACCAGCAGCACCGGCAGCGGCGGAGGATCCACTGGAGCTAGCAATGGTGCCTCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
11759R-2.in silico     241 GCCATGACCAGCAGCACCGGCAGCGGCGGAGGATCCACTGGAGCTAGCAATGGTGTCTCG 300


11759R-2.IR_full       301 AATGCCCTGAGTGCCGCCACGCCCACGGCGGATGTGTCCATAAACAATATCGATGAATAT 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
11759R-2.in silico     301 AATGCCCTGAGTGCCGCCACGCCCACGGCGGATGTGTCCATAAACAATATCGATGAGTAT 360


11759R-2.IR_full       361 GTGGAGCTGCTGTACGAGGAGCTGGGCGAACGCATTCGAGGCTCGGCCATGATCCTACAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11759R-2.in silico     361 GTGGAGCTGCTGTACGAGGAGCTGGGCGAACGCATTCGAGGCTCGGCCATGATCCTACAG 420


11759R-2.IR_full       421 ATGGCGCGAAATCCCGATAATCTTGAAGAGCTGGAAAAGAATGAAGCCTGCCTCAGCGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11759R-2.in silico     421 ATGGCGCGAAATCCCGATAATCTTGAAGAGCTGGAAAAGAATGAAGCCTGCCTCAGCGCC 480


11759R-2.IR_full       481 TTGTCACGTGTTCTGCGCGAGG 502
                           ||||||||||||||||||||||
11759R-2.in silico     481 TTGTCACGTGTTCTGCGCGAGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
0   NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
0   NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
0   NM_143436.1  CG2006-RA (CG2006), mRNA 
0   NM_166229.2  CG14478-RA, transcript variant A (CG14478), mRNA 
0   NM_137370.3  CG14478-RB, transcript variant B (CG14478), mRNA 
0   NM_130642.1  CG14050-RA (CG14050), mRNA 
0   11  NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   11  NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_206056.2  CG8715-RC, transcript variant C (lig), mRNA 
0   NM_136504.3  CG8715-RA, transcript variant A (lig), mRNA 
0   NM_165586.2  CG8715-RB, transcript variant B (lig), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   NM_136425.2  CG11107-RA (CG11107), mRNA 
0   NM_057245.2  CG6189-RA (l(1)1Bi), mRNA 
0   NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   NM_001015271.1  CG40368-PB.3 (CG40368), mRNA 
0   NM_135094.2  CG6957-RA, transcript variant A (Oscillin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.